Application of miR-296-3p to preparation of kit for diagnosing prostate cancer generation or migration
A diagnostic kit and technology for prostate cancer, applied in the field of biomedical materials, can solve the rare miR-296-3p and other problems
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0056] Example 1. Migration ability and morphological differences between P69 and M12 and differential expression of miR-296-3p in the two cells
[0057] 1. Cell migration assay (Migration)
[0058] (1) Assemble CIM-16: divide the lower chamber into two groups, add 160ul of SFM (serumfree medium) to each well of the control group, add 160ul of full medium (5% FBS) to each well of the serum induction group; add 30-50ul to each well of the upper chamber SFM;
[0059] (2) Balance: put CIM-16 into a 37°C incubator to balance for 1 hour;
[0060] (3) Detection background: RT-CADP Analyzer detects the basic value of CIM-16;
[0061] (4) Prepare cells: after starvation of cells for 6-8 hours, digest with 0.05% Typsin, count cells, and adjust the density to 4×10 5 / ml, standby;
[0062] (5) Seed plate: add 100ul single cell suspension to each well of the upper chamber, and equilibrate at room temperature for 30min;
[0063] (6) Measurement: Put CIM-16 into RT-CA DP Analyzer, star...
Embodiment 2
[0159] Example 2. miR-296-3p directly targets E-cadherin
[0160] 1. Construction of stable transfected cell lines
[0161] P69 or M12 cells were planted in a 6cm dish, and when they grew to a confluence of 50%-60%, they were infected with viral supernatants containing miR-296-3p and anti-miR-296-3p respectively. The reagents used For Lipofectamine2000 (Invitrogen) and Optimal-MEM (Gibco), transfection was performed according to the instructions of the conventional method. After 24 hours, the medium was changed and the expression of green fluorescent protein was observed under a fluorescent microscope to determine the transfection efficiency of the cells. Puromycin selection was performed 48 hours later. The nucleotide sequences used for transfection are as described in Examples 1.5 and 1.6. in:
[0162] The sequence of miR-296-3p is: gagggttgggtggaggctctcc, as shown in SEQ ID NO:7;
[0163] The sequence of anti-miR-296-3p is: ggagagcctccacccaaccctc, as shown in SEQ ID NO...
Embodiment 3
[0206] Example 3. miR-296-3p promotes the process of metastasis by inhibiting the expression of E-cadherin
[0207] 1. Cell migration assay (Migration)
[0208] Implementation method is with the way of 1 in embodiment 1.
[0209] Such as image 3 A, After miR-296-3p was transferred, obvious migration phenomenon appeared within 24 hours, and the CI value of the migration curve was significantly higher than that of the control cells, indicating that miR-296-3p can promote cell migration.
[0210] Such as image 3 B, After miR-296-3p and E-cadherin were transferred into P69 cells at the same time, the promoting effect of miR-296-3p on cell migration was inhibited. figure 2 C, It can be concluded that the promoting effect of miR-296-3p on cell migration is achieved by inhibiting the expression of E-cadherin.
[0211] 2. Cell invasion assay (Invasion)
[0212] (1) Glue spreading: Melt Matrigel in an ice box at 4°C overnight, dilute Matrigel with cold SFM at a ratio of 1:20, a...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap