Check patentability & draft patents in minutes with Patsnap Eureka AI!

Application of miR-296-3p to preparation of kit for diagnosing prostate cancer generation or migration

A diagnostic kit and technology for prostate cancer, applied in the field of biomedical materials, can solve the rare miR-296-3p and other problems

Active Publication Date: 2014-01-08
SHANGHAI JIAOTONG UNIV SCHOOL OF MEDICINE
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The miR-296 reported in the existing literature is mostly miR-296-5p, and there are only 6 reports on miR-296-3p [9-14], one of which is mainly aimed at the drug resistance of glioblastoma [9], other studies mainly focus on miR-296-3p and other miRNAs to jointly regulate the expression of one or some genes [10], and there are few studies on the function of miR-296-3p on tumor growth and metastasis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of miR-296-3p to preparation of kit for diagnosing prostate cancer generation or migration
  • Application of miR-296-3p to preparation of kit for diagnosing prostate cancer generation or migration
  • Application of miR-296-3p to preparation of kit for diagnosing prostate cancer generation or migration

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] Example 1. Migration ability and morphological differences between P69 and M12 and differential expression of miR-296-3p in the two cells

[0057] 1. Cell migration assay (Migration)

[0058] (1) Assemble CIM-16: divide the lower chamber into two groups, add 160ul of SFM (serumfree medium) to each well of the control group, add 160ul of full medium (5% FBS) to each well of the serum induction group; add 30-50ul to each well of the upper chamber SFM;

[0059] (2) Balance: put CIM-16 into a 37°C incubator to balance for 1 hour;

[0060] (3) Detection background: RT-CADP Analyzer detects the basic value of CIM-16;

[0061] (4) Prepare cells: after starvation of cells for 6-8 hours, digest with 0.05% Typsin, count cells, and adjust the density to 4×10 5 / ml, standby;

[0062] (5) Seed plate: add 100ul single cell suspension to each well of the upper chamber, and equilibrate at room temperature for 30min;

[0063] (6) Measurement: Put CIM-16 into RT-CA DP Analyzer, star...

Embodiment 2

[0159] Example 2. miR-296-3p directly targets E-cadherin

[0160] 1. Construction of stable transfected cell lines

[0161] P69 or M12 cells were planted in a 6cm dish, and when they grew to a confluence of 50%-60%, they were infected with viral supernatants containing miR-296-3p and anti-miR-296-3p respectively. The reagents used For Lipofectamine2000 (Invitrogen) and Optimal-MEM (Gibco), transfection was performed according to the instructions of the conventional method. After 24 hours, the medium was changed and the expression of green fluorescent protein was observed under a fluorescent microscope to determine the transfection efficiency of the cells. Puromycin selection was performed 48 hours later. The nucleotide sequences used for transfection are as described in Examples 1.5 and 1.6. in:

[0162] The sequence of miR-296-3p is: gagggttgggtggaggctctcc, as shown in SEQ ID NO:7;

[0163] The sequence of anti-miR-296-3p is: ggagagcctccacccaaccctc, as shown in SEQ ID NO...

Embodiment 3

[0206] Example 3. miR-296-3p promotes the process of metastasis by inhibiting the expression of E-cadherin

[0207] 1. Cell migration assay (Migration)

[0208] Implementation method is with the way of 1 in embodiment 1.

[0209] Such as image 3 A, After miR-296-3p was transferred, obvious migration phenomenon appeared within 24 hours, and the CI value of the migration curve was significantly higher than that of the control cells, indicating that miR-296-3p can promote cell migration.

[0210] Such as image 3 B, After miR-296-3p and E-cadherin were transferred into P69 cells at the same time, the promoting effect of miR-296-3p on cell migration was inhibited. figure 2 C, It can be concluded that the promoting effect of miR-296-3p on cell migration is achieved by inhibiting the expression of E-cadherin.

[0211] 2. Cell invasion assay (Invasion)

[0212] (1) Glue spreading: Melt Matrigel in an ice box at 4°C overnight, dilute Matrigel with cold SFM at a ratio of 1:20, a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of miR-296-3p to preparation of a kit for diagnosing prostate cancer generation or migration. Researches show that miR-296-3p acts on a target gene CDH1 (cadherin) of miR-296-3p to ensure that the transcription is inhibited or degraded, E-cadherin expression is reduced, so that the prostate cancer migration invasion is promoted. After the miR-296-3p is over-expressed, the expression level of the E-cadherin is reduced, adhesion among tumor cells is weakened, and migration invasion capacity is improved. Therefore, through detecting the expression of the E-cadherin and miRNA-296-3p, the prostate cancer migration can be diagnosed and pathologically graded, and migration and prognosis are evaluated. A tumor migration intervention strategy can be designed according to the characteristic that the miR-296-3p targets the E-cadherin, and the application of anti-miR-296-3p to the preparation of drugs for inhibiting the prostate cancer invasion migration is provided. The invention has an important practical significance and a huge potential application value in the fields of medicines and bio-pharmaceuticals.

Description

technical field [0001] The invention relates to the technical field of biomedical materials. The invention discloses the use of a small molecule non-coding RNA, in particular the application of a small molecule non-coding RNA, namely miR-296-3p, in the preparation of a tumorigenesis or metastasis diagnostic kit . Background technique [0002] Prostate cancer (Pca) is a malignant tumor that occurs in male prostate tissue. Its onset increases with age. Its onset is hidden, its growth is slow, and its etiology is complex, which brings great obstacles to early clinical diagnosis. Prostate cancer is prone to lymph node metastasis and bone metastasis, which is the main cause of death in prostate cancer patients and has always been a hot spot in basic and clinical research. Common treatment methods for prostate cancer mainly include endocrine therapy, surgery, chemotherapy and radiotherapy. Relatively newer immunotherapy and gene therapy also have great application potential. In...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68
Inventor 余健秀闫洁黄建王艳丽
Owner SHANGHAI JIAOTONG UNIV SCHOOL OF MEDICINE
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More