Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for producing recombinant duck-beta-defensin-2 protein

A production method and defensin technology, which are applied in the field of animal biomedical engineering, can solve the problems of complicated procedures, high cost, limitations, etc., and achieve the effects of increasing the expression amount, being beneficial to maintenance, and having high production efficiency.

Active Publication Date: 2014-12-10
FOSHAN UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Due to the low content of natural defensins in animals, direct extraction is far from meeting the needs, and the cost is high, the yield is low, and the process is complicated; chemical synthesis is feasible but the cost is too high, and the application is limited; with the development of genetic engineering technology, through genetic recombination It is possible to produce defensin peptides with technology to meet the needs of research and production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0027] Now in conjunction with embodiment the present invention is described in further detail:

[0028] The duck β-defensin-2 (AvBD2) gene nucleotide sequence design and in vitro synthesis process of the present invention are realized in this way,

[0029] Referring to the cDNA gene sequence of the duck AvBD2 gene registered in GenBank, the nucleotide sequence of the mature peptide of the duck AvBD2 gene was modified according to the yeast codon preference, and then synthesized by gene synthesis (sent to Shanghai Sangong Bioengineering Technology Co., Ltd. gene synthesis), the nucleotide sequence of the duck β-defensin-2 (AvBD2) gene synthesized after transformation is as follows:

[0030] GATATGTTTTTGTGTAGAATTGGTTCTTGTCATTTTGGTAGATGTCCAATTCATTTGGTTAGAGTTGGTTCCTGTTTTGGTTTTAGATCTTGTTGTAAGTCTCCATGGGATGTTTAA.

[0031] The recombinant plasmid pPICZα-A-AvBD2 containing the gene of the present invention is realized in this way,

[0032] The construction process of the recombinant...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
capacitanceaaaaaaaaaa
electrical resistanceaaaaaaaaaa
Login to View More

Abstract

A method for producing a recombinant duck-beta-defensin-2 protein. The method is characterized by comprising an in vitro inducible expression process of a yeast recombinant converter containing duck beta-defensin-2. The process is as below: (1) induced expression of a positive yeast converter. Results show that mycelium protein subjected to induced culture has a quite obvious expression band of 4.32kD compared with a control group, which is not induced; through efficient liquid chromatography-tandem mass spectrometry identification, the mycelium protein has an amino acid sequence consistent with that of an objective protein; therefore, the target gene has been expressed, and the recombinant duck beta--defensin-2 protein has been produced. Compared with the prior art, the invention has advantages of antibiosis, growth activity promoting, suitability for application in animal production, low cost and high production efficiency.

Description

technical field [0001] The invention relates to a gene production method in the field of animal biomedical engineering. Background technique [0002] Animals used in modern animal husbandry are increasingly sensitive to environmental stress and pathogens while having high productivity. Especially under intensive feeding conditions, feeding animals face more stress and invasion of pathogens. There is an urgent need for a high-efficiency, non-toxic, non-residue immune enhancer and growth enhancer in animal husbandry production. While improving the disease resistance of feed animals, it can also improve the production performance of feed animals and the safety of animal products, so as to Promote the healthy development of animal husbandry and reduce the damage of animal husbandry to human health and the ecological environment. Previous studies have found that defensins have broad-spectrum bactericidal activity and super antimicrobial effect, and the mechanism of action is sp...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12P21/02C12R1/84
Inventor 张辉华韩小凤马保华毕英佐马静云谢青梅李辰
Owner FOSHAN UNIVERSITY