Method for producing recombinant duck-beta-defensin-2 protein
A production method and defensin technology, which are applied in the field of animal biomedical engineering, can solve the problems of complicated procedures, high cost, limitations, etc., and achieve the effects of increasing the expression amount, being beneficial to maintenance, and having high production efficiency.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment Construction
[0027] Now in conjunction with embodiment the present invention is described in further detail:
[0028] The duck β-defensin-2 (AvBD2) gene nucleotide sequence design and in vitro synthesis process of the present invention are realized in this way,
[0029] Referring to the cDNA gene sequence of the duck AvBD2 gene registered in GenBank, the nucleotide sequence of the mature peptide of the duck AvBD2 gene was modified according to the yeast codon preference, and then synthesized by gene synthesis (sent to Shanghai Sangong Bioengineering Technology Co., Ltd. gene synthesis), the nucleotide sequence of the duck β-defensin-2 (AvBD2) gene synthesized after transformation is as follows:
[0030] GATATGTTTTTGTGTAGAATTGGTTCTTGTCATTTTGGTAGATGTCCAATTCATTTGGTTAGAGTTGGTTCCTGTTTTGGTTTTAGATCTTGTTGTAAGTCTCCATGGGATGTTTAA.
[0031] The recombinant plasmid pPICZα-A-AvBD2 containing the gene of the present invention is realized in this way,
[0032] The construction process of the recombinant...
PUM
| Property | Measurement | Unit |
|---|---|---|
| capacitance | aaaaa | aaaaa |
| electrical resistance | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 