Synthesized duck beta-defensins-2 gene, recombinant plasmid containing gene as well as production methods for recombinant yeast transformant and recombinant duck beta-defensins-2 protein

A defensin and gene technology, applied in the field of animal biomedical engineering, can solve the problems of complicated procedures, low yield and high cost, and achieve the effect of maintaining and increasing expression

Inactive Publication Date: 2013-06-12
FOSHAN UNIVERSITY
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Due to the low content of natural defensins in animals, direct extraction is far from meeting the needs, and the cost is high, the yield is low, and the process is complicated; chemical synthesis is feasible but the cost is too high, and the application is limited; with the development of genetic engineering technology, through genetic recombination It is possible to produce defensin peptides with technology to meet the needs of research and production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0027] Now in conjunction with embodiment the present invention is described in further detail:

[0028] The duck β-defensin-2 (AvBD2) gene nucleotide sequence design and in vitro synthesis process of the present invention are realized in this way,

[0029] Referring to the cDNA gene sequence of the duck AvBD2 gene registered in GenBank, the nucleotide sequence of the mature peptide of the duck AvBD2 gene was modified according to the yeast codon preference, and then synthesized by gene synthesis (sent to Shanghai Sangong Bioengineering Technology Co., Ltd. gene synthesis), the nucleotide sequence of the duck β-defensin-2 (AvBD2) gene synthesized after transformation is as follows:

[0030] GATATGTTTTTGTGTAGAATTGGTTCTTGTCATTTTGGTAGATGTCCAATTCATTTGGTTAGAGTTGGTTCCTGTTTTGGTTTTAGATCTTGTTGTAAGTCTCCATGGGATGTTTAA.

[0031] The recombinant plasmid pPICZα-A-AvBD2 containing the gene of the present invention is realized in this way,

[0032] The construction process of the recombinant...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
capacitanceaaaaaaaaaa
electrical resistanceaaaaaaaaaa
Login to view more

Abstract

The invention discloses a synthesized duck beta-defensins-2 gene, a recombinant plasmid containing the gene as well as production methods for a recombinant yeast transformant and a recombinant duck beta-defensins-2 protein. The recombinant duck beta-defensins-2 gene refers to the cDNA (complementary Deoxyribonucleic Acid) gene sequence of a duck AvBD2 gene registered in GenBank; meanwhile, the nucleotide sequence in a mature peptide segment of the duck AvBD2 gene is transformed according to the preference of a yeast codon; the duck beta-defensins-2 gene is synthesized by using a gene synthetic method; the construction process of the recombinant plasmid containing the gene sequentially comprises the following steps of: firstly, setting an upstream primer and a downstream primer of the duckbeta-defensins-2 gene; secondly, carrying out PCR (Polymerase Chain Reaction) amplification on a duck beta-defensins-2 gene segment; and thirdly, constructing a recombinant plasmid pPICZalpha-A-AvBD2. The production method for the recombinant duck beta-defensins-2 protein comprises the following steps of: firstly, preparing and linearizing the recombinant plasmid; secondly, preparing a competent cell obtained by electrotransformation of pichia pastoris; and thirdly, electroporating the pichia pastoris. The production method for the recombinant duck beta-defensins-2 protein comprises the step of induced expression of the positive yeast transformant. Compared with the prior art, synthesized duck beta-defensins-2 gene, the recombinant plasmid and the production methods disclosed by the invention have the advantages of activities of resisting bacteria and promoting the growth, suitability for application to the livestock production, low production cost and high production efficiency.

Description

technical field [0001] The invention relates to a gene synthesis, recombinant plasmid construction, recombinant yeast transformant acquisition and recombinant protein production method in the field of animal biomedical engineering. Background technique [0002] Animals used in modern animal husbandry are increasingly sensitive to environmental stress and pathogens while having high productivity. Especially under intensive feeding conditions, feeding animals face more stress and invasion of pathogens. There is an urgent need for a high-efficiency, non-toxic, non-residue immune enhancer and growth enhancer in animal husbandry production. While improving the disease resistance of feed animals, it can also improve the production performance of feed animals and the safety of animal products, so as to Promote the healthy development of animal husbandry and reduce the damage of animal husbandry to human health and the ecological environment. Previous studies have found that defen...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/12C12R1/84
Inventor 张辉华韩小凤马保华毕英佐马静云谢青梅李辰
Owner FOSHAN UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products