Unlock instant, AI-driven research and patent intelligence for your innovation.

Volvaria volvacea V14 strain molecular specific detection markers and detection method

A technology for detection of markers and detection methods, which is applied in biochemical equipment and methods, measurement/inspection of microorganisms, DNA/RNA fragments, etc., and can solve the difficulties in the selection of new varieties of straw mushrooms without lock joints in the hyphae of straw mushrooms , The mode of sexual reproduction of straw mushrooms has not yet been clearly ascertained, achieving the effects of high accuracy, accelerated research and development work, and short detection time

Inactive Publication Date: 2015-05-06
SHANGHAI ACAD OF AGRI SCI
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The hyphae of variola volvacea do not have lock-like associations. In classical genetic studies, variola volvacea is the only basidiomycete identified as belonging to the primary homothalmic union reproduction mode among edible fungi. Although the whole genome sequence of the V23 strain has been At present, there are still many controversies about the genetics research of V. volvulus, especially the research on reproductive mode.
These studies have not yet clearly ascertained the mode of sexual reproduction of straw mushrooms. The lack of basic theoretical research has restricted the development of straw mushroom breeding and brought many difficulties to the selection and breeding of new varieties of straw mushrooms.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Volvaria volvacea V14 strain molecular specific detection markers and detection method
  • Volvaria volvacea V14 strain molecular specific detection markers and detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Genomic DNA extraction

[0031] Strain V14 of straw mushroom was inoculated on PDA plate medium, cultured at 32°C for 5 days, scraped the surface mycelium and put it into a sterile centrifuge tube, and stored it in a -70°C refrigerator for later use. Genomic DNA was extracted by the improved CTAB method, and the DNA was stored in a -20°C refrigerator for later use.

[0032] The operation steps of the CTAB method are as follows:

[0033] 1. Put the collected mycelium into a sterilized pre-cooled mortar and grind it into powder, add 2×CTAB extract (2% CTAB; 1.4M NaCl; 100mM Tris.Cl, pH8.0) preheated at 65°C ; 20mM EDTA, pH8.0), transfer to 2mL centrifuge tube, 65℃ water bath for 1h;

[0034] 2. Centrifuge the mixture at 12,000 rpm at 4°C for 10 minutes, take the supernatant and add an equal volume of phenol:chloroform (1:1) mixture, mix gently, and let stand for 15 minutes;

[0035] 3. Centrifuge the mixture at 12,000 rpm at 4°C for 10 minutes, take the supernatant and...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a volvaria volvacea V14 strain molecular specific detection markers and a detection method thereof. The specific detection markers are V14F: GAGCAACCGAACCTCAACAACAC and V14R: CGCCGTGTCCGTTCATACCAAGC. The detection method comprises the steps that: the volvaria volvacea V14 strain is inoculated to a PDA plate medium, and is cultured for 3-5 days under a temperature of 32 DEG C; surface mycelium is scraped and placed into a sterile centrifuge tube; genome DNA is extracted by using an improved CTAB method, such that DNA is obtained; the extracted DNA is adopted as a template, the specific detection marker primers are adopted as amplification primers, and PCR amplification is carried out, such that a PCR amplification product is obtained; and electrophoresis is carried out. Compared with conventional morphological test, antagonism test, and fruiting test, the method provided by the invention has the advantages of short detection time and high accuracy.

Description

technical field [0001] The invention belongs to the field of straw mushroom strain labeling and detection, and in particular relates to a molecular-specific detection label and a detection method of the straw mushroom V14 strain. Background technique [0002] Straw mushroom (Volvariella volvacea) cultivation originated in China, has a cultivation history of more than 300 years so far, and is widely cultivated in southern my country. Straw mushrooms are delicious, not only rich in nutritional value, but also have an important role in health care, and are deeply loved by consumers. Straw mushroom is a high-temperature cultivated edible fungus. Compared with other edible fungi, its remarkable feature is that its growth rate is extremely fast. It usually only takes 2 weeks from sowing to harvesting. Its annual output has always ranked first in my country's edible fungi industry. Top ten. [0003] The hyphae of variola volvacea do not have lock-like associations. In classical ge...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68C12N15/11
Inventor 汪虹陈明杰鲍大鹏冯爱萍
Owner SHANGHAI ACAD OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More