LAMP detection primer group of NPT II marker screening gene, kit and detection method
A detection kit and gene screening technology, which is applied in biochemical equipment and methods, recombinant DNA technology, microbial measurement/inspection, etc., can solve the problems of rare agricultural products marked with transgenic words, and achieve high sensitivity, Ease of identification and simple operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] The LAMP detection primer set of the NPTII marker screening gene provided in this embodiment one includes the following primers:
[0041] Outer primer F3: CTCGACGTTGACTCTGATG;
[0042] Outer primer B3: TGATGCTCATCGTCCAGT;
[0043] Inner primer FIP:
[0044] TAGCCGGTTCATGCGTATGCTCATCTCACCTTGCACCT;
[0045] Inner primer BIP:
[0046] CCTATCGTCCACCTTGCGACTTCCAGTTCGACTTGACC;
[0047] Loop Primer FLP: TTGCATCTGCCATGTAGGTTA;
[0048] Loop Primer BLP: CGTTCACGGTTGGATGCC. .
[0049] The test kit of the NPTII marker screening gene provided by the present embodiment one includes the following components:
[0050]
[0051]
[0052] ; Wherein, each primer in the primer liquid corresponds to each primer in the LAMP detection primer set of the BAR gene.
[0053] The method for detecting the sample to be tested provided in this embodiment 1 specifically includes the following steps:
[0054] (101) extracting the template DNA to be tested from the sample to be tested;
[...
Embodiment 2
[0069] In this example, the sensitivity experiment is mainly carried out to the detection method provided in Example 1, specifically:
[0070] The DNA solution (purity: 10%) of the transgenic maize MON863 containing the NPTII marker screening gene was diluted with the DNA solution of non-transgenic rice respectively into five mixed solutions with different purities, and in the five mixed solutions, the DNA of the transgenic maize MON863 The purity is 5%, 1%, 0.5%, 0.1%, 0.05% respectively; each mixed solution takes 2 μ L respectively, all replaces the step (102) described in the additional operation embodiment 1 of the template DNA to be tested; 2 O is used as a negative control, and the DNA solution of corn flour containing the NPTII marker screening gene is used as a positive control, and the template DNA to be tested is replaced by the step (102) described in Example 1 in addition.
[0071] In this paper, the parameters of the DNA solution of the transgenic maize MON863 con...
Embodiment 3
[0076] In this example, the primers provided in Example 1 are mainly tested for specificity, specifically:
[0077] Use mung beans, broad beans, pigs, oats, oranges, sheep, ducks, potatoes, honey pears, grass shrimp, chickpeas, chickens, geese, rice, white cloud beans, green beans, cowpeas, buckwheat, tomatoes, almonds, walnuts, The DNA of the donkey replaces the step (102) described in the additional operation embodiment one of the template DNA to be detected respectively; With ddH 2 O is used as a negative control, and the DNA solution of corn flour containing the NPTII marker screening gene is used as a positive control, and the template DNA to be tested is replaced by the step (102) described in Example 1 in addition.
[0078] For some experimental results, see image 3 shown in image 3 Among them, the lines CH31-CH38 correspond to the DNA solution of corn flour containing the NPTII marker screening gene, ddH 2 O, mung beans, broad beans, pigs, oats, oranges, sheep.
...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 