Unlock instant, AI-driven research and patent intelligence for your innovation.

LAMP detection primer group of NPT II marker screening gene, kit and detection method

A detection kit and gene screening technology, which is applied in biochemical equipment and methods, recombinant DNA technology, microbial measurement/inspection, etc., can solve the problems of rare agricultural products marked with transgenic words, and achieve high sensitivity, Ease of identification and simple operation

Inactive Publication Date: 2015-05-20
唐食明 +2
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although our country stipulates that all genetically modified crops and their by-products should be marked since March 20, 2002, but under the situation of increasing number of genetically modified crops, it is still rare to see agricultural products marked with genetically modified words

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • LAMP detection primer group of NPT II marker screening gene, kit and detection method
  • LAMP detection primer group of NPT II marker screening gene, kit and detection method
  • LAMP detection primer group of NPT II marker screening gene, kit and detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] The LAMP detection primer set of the NPTII marker screening gene provided in this embodiment one includes the following primers:

[0041] Outer primer F3: CTCGACGTTGACTCTGATG;

[0042] Outer primer B3: TGATGCTCATCGTCCAGT;

[0043] Inner primer FIP:

[0044] TAGCCGGTTCATGCGTATGCTCATCTCACCTTGCACCT;

[0045] Inner primer BIP:

[0046] CCTATCGTCCACCTTGCGACTTCCAGTTCGACTTGACC;

[0047] Loop Primer FLP: TTGCATCTGCCATGTAGGTTA;

[0048] Loop Primer BLP: CGTTCACGGTTGGATGCC. .

[0049] The test kit of the NPTII marker screening gene provided by the present embodiment one includes the following components:

[0050]

[0051]

[0052] ; Wherein, each primer in the primer liquid corresponds to each primer in the LAMP detection primer set of the BAR gene.

[0053] The method for detecting the sample to be tested provided in this embodiment 1 specifically includes the following steps:

[0054] (101) extracting the template DNA to be tested from the sample to be tested;

[...

Embodiment 2

[0069] In this example, the sensitivity experiment is mainly carried out to the detection method provided in Example 1, specifically:

[0070] The DNA solution (purity: 10%) of the transgenic maize MON863 containing the NPTII marker screening gene was diluted with the DNA solution of non-transgenic rice respectively into five mixed solutions with different purities, and in the five mixed solutions, the DNA of the transgenic maize MON863 The purity is 5%, 1%, 0.5%, 0.1%, 0.05% respectively; each mixed solution takes 2 μ L respectively, all replaces the step (102) described in the additional operation embodiment 1 of the template DNA to be tested; 2 O is used as a negative control, and the DNA solution of corn flour containing the NPTII marker screening gene is used as a positive control, and the template DNA to be tested is replaced by the step (102) described in Example 1 in addition.

[0071] In this paper, the parameters of the DNA solution of the transgenic maize MON863 con...

Embodiment 3

[0076] In this example, the primers provided in Example 1 are mainly tested for specificity, specifically:

[0077] Use mung beans, broad beans, pigs, oats, oranges, sheep, ducks, potatoes, honey pears, grass shrimp, chickpeas, chickens, geese, rice, white cloud beans, green beans, cowpeas, buckwheat, tomatoes, almonds, walnuts, The DNA of the donkey replaces the step (102) described in the additional operation embodiment one of the template DNA to be detected respectively; With ddH 2 O is used as a negative control, and the DNA solution of corn flour containing the NPTII marker screening gene is used as a positive control, and the template DNA to be tested is replaced by the step (102) described in Example 1 in addition.

[0078] For some experimental results, see image 3 shown in image 3 Among them, the lines CH31-CH38 correspond to the DNA solution of corn flour containing the NPTII marker screening gene, ddH 2 O, mung beans, broad beans, pigs, oats, oranges, sheep.

...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an LAMP detection primer group of an NPT II marker screening gene, a kit and a detection method, wherein the LAMP detection primer group includes the following primers of an outer primer F3: CTCGACGTTGACTCTGATG, an outer primer B3: TGATGCTCATCGTCCAGT, an inner primer FIP: TAGCCGGTTCATGCGTAT GCTCATCTCACCTTGCACCT, an inner primer BIP: CCTATCGTCCACCTTGCGACTTC CAGTTCGACTTGACC, a loop primer FLP: TTGCATCTGCCATGTAGGTTA and a ring primer BLP: CGTTCACGGTTGGATGCC. The LAMP detection primer group provided by the invention has good specificity for the NPT II marker screening gene.

Description

【Technical field】 [0001] The invention belongs to the field of food safety and relates to a loop-mediated isothermal amplification technology, in particular to a LAMP detection primer set, a kit and a detection method for transgenic crops containing NPTII marker screening genes. 【Background technique】 [0002] Transgenic crops refer to plants and their offspring produced by integrating foreign genes into the genome of recipient plants and changing their genetic composition by using recombinant DNA technology, also known as genetically modified organisms (GMOs). Since the first genetically modified plant came out in 1983, the acreage and sales revenue of global genetically modified crops have grown exponentially. But in a serious scientific sense, there is still no definitive conclusion on the biosafety of genetically modified agricultural products. Although our country stipulates that all genetically modified crops and their by-products should be marked since March 20, 2002...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68C12N15/11
Inventor 唐食明钱振杰冯家望刘李登王小玉邝筱珊胡松楠
Owner 唐食明