Preparation method and applications of antibacterial peptide

An antimicrobial peptide and expression system technology, applied in the field of antimicrobial peptide preparation, can solve the problems of low yield of gene expression, complicated separation and purification process, small molecular weight of antimicrobial peptide, etc., achieve high purity of antimicrobial peptide, improve protein purity, and easy operation Effect

Active Publication Date: 2013-12-25
GENLOCI BIOTECH
View PDF5 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Antimicrobial peptides have small molecular weight and are easily hydrolyzed by proteases. The separ

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method and applications of antibacterial peptide
  • Preparation method and applications of antibacterial peptide
  • Preparation method and applications of antibacterial peptide

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

[0050] Example 1 Preparation of antimicrobial peptide GBB using a non-fusion tag expression system

[0051] 1. Construction of pET28a-GBB vector

[0052] According to the literature Lee EK et al. Peptides. 2011, 32(6): 1123-30. The amino acid sequence of the antimicrobial peptide GBB disclosed: GRFKRFRKKFKKLFKKLS* (SEQ ID NO. 1), the gene sequence P1 of the antimicrobial peptide GBB was translated and designed using The software Genetyx designed the complementary sequence P2 of P1, using the annealed products of P1 and P2 as templates, and P3 and P4 as primers, by PCR (PCR conditions: 98℃ 1min; 98℃ 15s, 63℃ 15s, 72℃ 15s, 35 cycles; 72℃5min) to obtain GBB gene, using Phusion DNA polymerase (NEB Biolabs), P1, P2, P3 and P4 sequence are as follows:

[0053] P1: 5'GGACGATTCAAACGGTTCCGGAAAAAATTCAAGAAACTATTCAAGAAATTGTCATG A3'SEQ ID NO.2;

[0054] P2: 5’TCATGACAATTTCTTGAATAGTTTCTTGAATTTTTTCCGGAACCGTTTGAATCGTCC3’SEQ ID NO.5;

[0055] P3: 5’GAAGGAGATATACCATG GGACGATTCAAACGGTTCCG 3’SEQ ID NO.6...

Example Embodiment

[0067] Example 2 Preparation of antibacterial peptide GBB using fusion tag expression system

[0068] 1. Construction of pET28a-proteinG-GBB vector

[0069] According to the literature Lee EK et al. Peptides. 2011, 32(6):1123-30. The amino acid sequence of the antimicrobial peptide GBB disclosed: GRFKRFRKKFKKLFKKLS*, the gene sequence P1 of the antimicrobial peptide GBB was translated and designed:

[0070] P1: 5'GGACGATTCAAACGGTTCCGGAAAAAATTCAAGAAACTATTCAAGAAATTGTCATG A3'SEQ ID NO.2.

[0071] 1) Design primers P5 and P6 using plasmid pCeMM NTAP (GS) (GenBank accession number EF467047) as a template, by PCR (PCR conditions: 98℃ 1min; 98℃ 20s, 60℃ 20s, 72℃ 20s, 35 cycles; 72℃ 5min ) Obtain the proteinG gene (fusion tag).

[0072] P5: 5’CAGCCATCATCATCATCATCACATGGGCACCCCCGCAGTCA3’SEQ ID NO.8; P6:

[0073] 5’GCCCTGGAAGTACAGGTTTTCACCAGAACCCTCAGTCACAGTGAATGTCTTCG3’SE Q ID NO.9.

[0074] 2) Design primers P7 and P8, first use the product of step 1) as a template to perform PCR reaction (PCR con...

Example Embodiment

[0095] Example 3 Bacteriostatic test of antibacterial peptide GBB

[0096] Take GBB solutions with concentrations of 5, 10, 20, 30, 40 and 50μM and 3 antibiotics (450mg / L ticarcillin sodium (Tic), 500mg / L carbenicillin (Car), 200mg / L cephalosporin). (Cef)) Right 10 8 / ml Agrobacterium EHA105 was treated for 2h and cultured at 28°C for 48h, the colonies were counted. Calculate the inhibition rate ( Picture 9 , Picture 10 ).

[0097] Antibacterial rate (%)=(positive control OD value—test OD value) / (positive control OD value—negative control OD value)×100

[0098] The results showed that the antibacterial peptide GBB had a bacteriostatic rate as high as 98%, which was significantly higher than the contrast group of three antibiotics with higher concentration.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides the gene of an antibacterial peptide. The gene is used for coding the antibacterial peptide with an amino acid sequence represented by SEQ ID No.1, and possesses one of the nucleotide sequences represented by SEQ ID No.2-4. The invention also provides a preparation method of the antibacterial peptide. The preparation method comprises following steps: (1) an expression system containing one of the nucleotide sequences represented by SEQ ID No.2-4 is constructed, wherein expression carriers are constructed, and cell transformation of host cells is realized by the expression carriers so as to obtain recombinant cells capable of realizing expression of the antibacterial peptide; (2) the recombinant cells are cultured so as to realize expression of the antibacterial peptide; and (3) the expression products are separated and purified so as to obtain the antibacterial peptide with the amino acid sequence represented by SEQ ID No.1. The antibacterial peptide can be used as an antibacterial agent in the fields of agriculture, food, hygienic products, medicine, cosmetic, biopesticide, biological feed additive, natural food antiseptics, and zoological and botanical resistance gene engineering.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a preparation method and application of an antibacterial peptide. Background technique [0002] The Agrobacterium-mediated method is widely used in the field of plant genetic engineering due to its advantages of simple operation, wide application range, and high transformation efficiency, and has a high degree of recognition. But at the same time, the adverse effects of Agrobacterium remaining after transformation on the follow-up work have become increasingly prominent. After the transformed plants are obtained, the residual status of Agrobacterium in the plants not only affects the survival rate of the transformed plants and the reliability of PCR test results, but also may cause genetic drift of exogenous genes, leading to environmental problems. [0003] Currently, researchers use antibiotics to remove residual Agrobacterium, but they cannot completely remove Agrobac...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/11C12N15/70A01N47/44A01P1/00A61K38/10A61K8/64A61P31/04A61Q11/00
Inventor凌建群孟广荣姜超谢雯凡唐启慧
OwnerGENLOCI BIOTECH