SSR molecular marking method of wheat grain hardness gene
A wheat grain and molecular marker technology, applied in biochemical equipment and methods, microbial determination/inspection, etc., can solve problems such as low detection sensitivity, and achieve the effect of high allelic diversity and high stability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment Construction
[0008] This specific embodiment adopts the following technical scheme: it designs a PCR primer containing the SSR in a nucleotide sequence closely linked with the hardness gene and has the characteristics of an SSR, and after performing PCR amplification on the target variety, the polyacrylamide electrophoresis , can determine the allelic variation of Pina and Pinb genes among varieties.
[0009] Described nucleotide sequence is:
[0010] TTATTACTCACCTCGATTTTTGTTTGTAAGTGTGTTTATTTATTGGTCAAAGATAATTGTTTCTGGGGAAAAATGAAGGATTAGAAGAAGCTTGTCATGTGCCGAATCTCAATCTTCGATAAACCAAGGGAGAATAATTAGAAAAGATGGCTATCTAATATGACTCATTGCACTTTCTAGGTCAGAATCAAAACCCTTTTATGGCATTGTACATGGGGAGGTGAGCTCTGTTCTAAGGTTAATCCTAACCCGTGTTGTTTGAAATACCTATTTACCCCCTCCGATGCATCTAGATCCTCGGACACCTTGTTAAAAAAAATTACTTCCTTGGAGACAAATACTATTTTGGAGAATAATGAAAATCATTTAGAAACATTTGACATGAACGACATGATTCCAGAGACAATAAAAAACTTAAAAACAAACGATGGATAAGAAGATGATGTCTTGATAAATCATTACTTGTCGAGTTGTCGTGTACTACTAGTCTGTAAAATACAGTCTCTAACAAATTTGGTACAATCTGAGATCCATCTTGAACAACCTGCA...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com