SSR molecular marking method of wheat grain hardness gene
A wheat grain and molecular marker technology, applied in biochemical equipment and methods, microbial determination/inspection, etc., can solve problems such as low detection sensitivity, and achieve the effect of high allelic diversity and high stability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment Construction
[0008] This specific embodiment adopts the following technical scheme: it designs a PCR primer containing the SSR in a nucleotide sequence closely linked with the hardness gene and has the characteristics of an SSR, and after performing PCR amplification on the target variety, the polyacrylamide electrophoresis , can determine the allelic variation of Pina and Pinb genes among varieties.
[0009] Described nucleotide sequence is:
[0010] TTATTACTCACCTCGATTTTTGTTTGTAAGTGTGTTTATTTATTGGTCAAAGATAATTGTTTCTGGGGAAAAATGAAGGATTAGAAGAAGCTTGTCATGTGCCGAATCTCAATCTTCGATAAACCAAGGGAGAATAATTAGAAAAGATGGCTATCTAATATGACTCATTGCACTTTCTAGGTCAGAATCAAAACCCTTTTATGGCATTGTACATGGGGAGGTGAGCTCTGTTCTAAGGTTAATCCTAACCCGTGTTGTTTGAAATACCTATTTACCCCCTCCGATGCATCTAGATCCTCGGACACCTTGTTAAAAAAAATTACTTCCTTGGAGACAAATACTATTTTGGAGAATAATGAAAATCATTTAGAAACATTTGACATGAACGACATGATTCCAGAGACAATAAAAAACTTAAAAACAAACGATGGATAAGAAGATGATGTCTTGATAAATCATTACTTGTCGAGTTGTCGTGTACTACTAGTCTGTAAAATACAGTCTCTAACAAATTTGGTACAATCTGAGATCCATCTTGAACAACCTGCA...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 