Unlock instant, AI-driven research and patent intelligence for your innovation.

Contains siRNA cell culture whitening essence that inhibits melanin production

A technology of inhibiting melanin and cell culture, applied in cosmetic preparations, dressing preparations, skin care preparations, etc., can solve the complex biosynthesis of melanin, and achieve the effects of avoiding pollution and deterioration, stable effect, and remarkable efficacy

Active Publication Date: 2017-11-21
奥思达干细胞有限公司
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the biosynthesis of melanin is very complicated, and it is formed by tyrosine-tyrosinase reaction in chromophore (immature melanin)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Contains siRNA cell culture whitening essence that inhibits melanin production

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0040] The present invention will be described in detail below with reference to the accompanying drawings and in combination with embodiments.

[0041] refer to figure 1 As shown, the specific implementation of this embodiment is as follows:

[0042] A cell culture whitening essence containing siRNA that inhibits melanin production, consisting of the following components: epidermal cell culture fluid concentrate 79.3%, melanin-inhibiting siRNA-liposome complex 0.5%, glycerin 20%, and hyaluronic acid 0.2 %. Prepared by the following steps:

[0043] Step 1) Select the target DNA sequence: the present invention uses tyrosinase as the target, and selects the tyrosinase gene according to the NCBI standard database of the National Institutes of Health in the United States tyr The fragment sequence is the target sequence; wherein, the target DNA sequence is:

[0044] ATGCTCCTGG CTGTTTTGTA CTGCCTGCTG TGGAGTTTCC AGACCTCCGC TGGCCATTTCCCTAGAGCCT GTGTCTCCTC TAAGAACCTG ATGGAGAAGG AAT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a whitening essence containing an siRNA (Small Interfering Ribose Nucleic Acid) cell culture for inhibiting generation of melanin. The whitening essence is prepared from an epidermal cell culture fluid, contains the siRNA used for inhibiting the expression of tyrosinase (Tyr) and is used for interdicting the generation of the melanin in skin tissue melanin cells. With the adoption of the whitening essence, the siRNA is coated by lipidosome, enters a skin and is used for exerting the gene inhibition action; and as the epidermal cell culture fluid is rich in growth factors, amino acid and vitamins excreted by epidermal cells, and cell growth factors with a definite content, glycerinum and hyaluronic acid are added, the moisturizing effect of the whitening essence is added. A method of preparing the whitening essence comprises the steps: designing a synthetic siRNA aiming at a tyr gene, preparing an siRNA-lipidosome compound, acquiring an umbilical cord tissue epidermis of a newborn, collecting the cell culture fluid, filtering, concentrating and adding an active component. The whitening essence is used for interdicting the generation of the melanin from the molecular level, provides multiple endogenous nutritional ingredients with the physiological activity for the skin and has the moisturizing effect.

Description

technical field [0001] The invention relates to an essence made from epidermal cell culture fluid, in particular to a cell culture whitening essence of siRNA inhibiting melanin production. Background technique [0002] At present, most whitening cosmetics contain hydrogen peroxide, hydroquinone, mercury, lead, enzymes and spices and other substances, which are directly irritating to the skin, and may also cause skin sensitivity, pigmentation, acne, etc., and even cause cancer. Moreover, because such cosmetics contain heavy metals, long-term use will cause accumulation of heavy metals, resulting in increased melanin, calmness, and even body poisoning. [0003] Most of the common essences on the market are plant extracts. The production process has undergone multiple extractions and purifications with organic solvents. The finished product contains a lot of organic solvent residues, which can cause allergic irritation to the skin and even damage the organs. It is not suitable ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): A61K8/98A61K8/60A61K8/73A61Q19/02A61Q19/00
Inventor 周萱
Owner 奥思达干细胞有限公司
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More