Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

32 results about "Tyr gene" patented technology

The TYR gene provides instructions for making an enzyme called tyrosinase. This enzyme is located in melanocytes, which are specialized cells that produce a pigment called melanin.

Transgenic zebrafish expressing gene Cas9 and construction method and application of transgenic zebrafish

The invention relates to a transgenic zebrafish expressing a gene Cas9 and a construction method and the application of the transgenic zebrafish. According to the transgenic zebrafish expressing the gene Cas9, the gene Cas9 is inserted into a gene Mitfa of the zebrafish. The transgenic zebrafish capable of expressing the gene Cas9 is constructed in a targeting way at the fixed point of the pigmentgene Mitfa through the CRISPR / Cas9 transgenic technology, and pigment fading is taken as a mark for screening the homozygous knockout line. Using the transgenic zebrafish to edit a gene Tyr and a gene ZFERV proves that the transgenic zebrafish is more effective in the gene knockout, and a homozygous knockout individual is obtained on the F0 generation. Compared with the application of the traditional CRISPR / Cas9 technology to the zebrafish, the gene editing efficiency of the Cas9 transgenic zebrafish is higher; and a simple effective tool is provided for the large-scale gene screening and theestablishment of a disease model.
Owner:YANGZHOU UNIV

Reconstructed ovum of albinism model pig and construction method thereof, and construction method of model pig

The invention relates to a reconstructed ovum of an albinism model pig and a construction method thereof, and a construction method of the model pig. According to the construction method of the reconstructed ovum, tyrosinase is knocked out to obtain the reconstructed ovum of the albinism model pig. The combination of a CRISPP / Cas9 gene knock-out technique and a somatic nucleus transplantation technique proves that the method for constructing the gene modified pig has high feasibility. The obtained TYR gene knock-out pig has the typical characteristics of albinism, can provide a reliable animal model for researching human albinism, can be applied to toxicity and anaphylaxis detection and many other aspects, and is hopeful to become a standardized experimental animal for albinism-like mice.
Owner:广州中科飞豚生物科技有限责任公司

Method for identifying molecules of recessive white feather genes of chicken

The invention belongs to the technical field of chicken molecule mark preparation, and in particular relates to and builds a method for identifying molecules of recessive white feather genes of chicken. In the method for identifying the molecules of the recessive white feather genes of the chicken, nucleotide sequences of recessive white feather control genes of the chicken (TYR genes inserted with retroviruses) and colored feather control genes TYR genes are utilized to design a primer pair 1 and a primer pair 2 respectively, wherein the primer pair 1 is used for detecting recessive white feather allelic genes; and the primer pair 2 is used for detecting colored feather allelic genes. The method comprises the following steps: extracting genomic DNA of the chicken to be identified and performing PCR amplification by using the primer pairs 1 and 2; performing electrophoresis detection on amplification products; judging the type of the feather color genes of the chicken according to electrophoresis results; if the amplification products are produced by only the primer pair 1, determining the feather color genes are recessive white feather homozygote (the phenotype is a white feather); if the amplification products are produced by only the primer pair 2, determining the feather color genes are non-recessive white feather homozygote (the phenotype is either a colored feather or the white feather); and if the amplification products are produced by both of the primer pairs 1 and 2, determining the feather color genes are recessive white feather heterozygote (the phenotype is either a colored feather or the white feather). The invention provides the quick and convenient method for identifying the molecules of the recessive white feather genes of the chicken.
Owner:HUAZHONG AGRI UNIV

Primer, kit and detection method for detecting recessive white feather locus genotype of chicken

The invention discloses a primer, a kit and a detection method for detecting a recessive white feather locus genotype of a chicken, belonging to the technical field of biology. According to the invention, a specific primer P1 of an allelic gene c is designed according to the fact that 7.7kb insertion (ev1) exists in a fourth intron of a TYR gene, a specific primer P2 of the allelic gene c is designed according to the fact that 7.7kb insertion (ev1) does not exist in a fourth intron of a PMEL17 gene, a primer P3 is a common downstream primer of the primer P1 and the primer P2, a whole genome of a to-be-detected chicken containing the TYR gene is taken as a template, the primers P1, P2 and P3 are put in the same PCR (Polymerase Chain Reaction), an amplified fragment of the PCR is subjected to agarose gel electrophoresis after once PCR, and the recessive white feather locus genotype of the TYR gene of the chicken is identified according to the result of the agarose gel electrophoresis. The method greatly improves the genotype judging efficiency and accuracy, the method is simple, the genotype judging time is short, no sequencing or restriction enzyme is needed, no special instrument is required, the cost is low, and the method is easy to popularize.
Owner:HENAN AGRICULTURAL UNIVERSITY

Probe for detecting common genetic diseases, gene chip, preparation method and application

The invention discloses a probe for detecting common genetic diseases, a gene chip, a preparation method and application. The preparation method comprises the following steps of according to genes ofthalassemia, phenylketonuria, spinal muscular atrophy, hepatolenticular degeneration, pseudomuscular hypertrophy, glycogen storage disease Type II, methylmalonic academia, methylmalonic aciduria-accompanied type cysteine peptiduria Type cb1C, and oculocutaneous albinism Type 1, constructing a target capturing area, and designing a capturing probe, wherein the target capturing area comprises all globin genes, important regulating areas, deleted mutation breakpoints and SNP (single nucleotide polymorphism) sites of alpha and beta genes, and SMN1, PAH, ATP7B, DMD, GAA, MUT, MMACHC and TYR genes.The probe for the gene mutation of common genetic diseases can be designed according to the related genes of nine types of genetic diseases, and the prepared probe can be used for detecting the nine types of genetic diseases, and be suitable for large-scale population diagnosis and screening.
Owner:TIANJIN MEDICAL LAB BGI +2

Application of skin color-associated SNP marker in genotyping of black-bone chickens

The invention provides an application of a skin color-associated SNP marker in genotyping of black-bone chickens. The SNP marker is located at 2228 bp upstream of a transcription initiation site in apromoter region of a TYR gene, and a base with polymorphism is adenine A or thymine T. The SNP genotype detection primer has high specificity, single detection band and accurate typing results. In combination with a provided detection method, the whole operation process is simpler and more efficient, and the cost is lower. Rapid and accurate individual screening is achieved, and a basis for breeding development and protection of black-bone chicken varieties is provided.
Owner:LESHAN NORMAL UNIV

Whitening essence containing siRNA (Small Interfering Ribose Nucleic Acid) cell culture for inhibiting generation of melanin

The invention discloses a whitening essence containing an siRNA (Small Interfering Ribose Nucleic Acid) cell culture for inhibiting generation of melanin. The whitening essence is prepared from an epidermal cell culture fluid, contains the siRNA used for inhibiting the expression of tyrosinase (Tyr) and is used for interdicting the generation of the melanin in skin tissue melanin cells. With the adoption of the whitening essence, the siRNA is coated by lipidosome, enters a skin and is used for exerting the gene inhibition action; and as the epidermal cell culture fluid is rich in growth factors, amino acid and vitamins excreted by epidermal cells, and cell growth factors with a definite content, glycerinum and hyaluronic acid are added, the moisturizing effect of the whitening essence is added. A method of preparing the whitening essence comprises the steps: designing a synthetic siRNA aiming at a tyr gene, preparing an siRNA-lipidosome compound, acquiring an umbilical cord tissue epidermis of a newborn, collecting the cell culture fluid, filtering, concentrating and adding an active component. The whitening essence is used for interdicting the generation of the melanin from the molecular level, provides multiple endogenous nutritional ingredients with the physiological activity for the skin and has the moisturizing effect.
Owner:奥思达干细胞有限公司

Purification method for domestic rabbits with Belgian hair color based on genotype selection

The invention provides a purification method for domestic rabbits with a Belgian hair color based on genotype selection. The purification method is applicable to purification of various domestic rabbits with the Belgian hair color, such as meat rabbits, rex rabbits, long hair rabbits and ornamental rabbits. The method provided by the invention comprises the following steps: firstly, selecting thedomestic rabbits with a hair color phenotype which is the Belgian hair color; then detecting an ASIP (Agouti Signaling Protein) gene, an MC1R (Melanocortin 1-Receptor) gene and a TYR (Tyrosinase) geneat the same time by utilizing a first primer group, a second primer group and a third primer group; screening the domestic rabbits with genotypes of AA (corresponding to the ASIP gene), EE (corresponding to the MC1R gene) and CC (corresponding to the TYR gene). The domestic rabbits with the genotype of AAEECC, which are obtained by the purification method, are Belgian hair color homozygotes and recessive white genes are eliminated. According to a domestic rabbit specialized line with the Belgian hair color, which is cultivated by the purification method, germplasm materials of breeding enterprises can be protected very well on the basis of ensuring that the hair colors of commercial rabbits are consistent.
Owner:SHANDONG AGRICULTURAL UNIVERSITY

Oculocutaneous albinism type 1 related mutated TYR gene and application thereof to gene diagnosis

The invention discloses an oculocutaneous albinism type 1 related mutated TYR gene and application thereof to gene diagnosis. By collection of a 4-generation oculocutaneous albinism type 1 family, a transmission manner of 4-generation oculocutaneous albinism type 1 in the family is an autosomal recessive inheritance manner according to judgment; by reading of documents and online databases, possible pathogenic candidate genes are selected, then a propositus and other members in the family are subjected to PCR (polymerase chain reaction) amplification and Sanger sequencing to determine mutant gene loci, and consequently a TYR pathogenic gene (mutant c.107G) which is a novel pathogenic mutation is discovered. Discovery of the novel TYR pathogenic gene mutation locus enriches a pathogenic gene mutation spectrum, and the novel TYR pathogenic gene mutation locus can be used as a prenatal diagnosis screening locus for oculocutaneous albinism type 1 which is a serious recessive hereditary disease to guide prenatal and postnatal care. By providing of the oculocutaneous albinism type 1 related mutated TYR gene, data support is provided for design of prenatal diagnosis chips, and especially,important significance to prenatal gene diagnosis screening of seriously-harmful rare genetic diseases is achieved.
Owner:HARBIN MEDICAL UNIVERSITY

SSCP (single strand conformation polymorphism) detecting method for animal liver bacterial toxin contamination

The invention discloses an SSCP (single strand conformation polymorphism) detecting method for animal liver bacterial toxin contamination, relates to the biological technical field and particularly relates to a detecting method for animal liver bacterial toxin contamination. According to the method, an SSCP technology is utilized to detect gene mutation of animal liver mitochondria contaminated by bacterial toxin, so that the technology is applied to evaluating and identifying animal food safety. Main steps comprise extracting host liver mitochondria DNA (deoxyribonucleic acid), amplifying the liver mitochondria tRNACys-Tyr gene segment by applying PCR(polymerase chain reaction)-SSCP technology, detecting a stripe with abnormal swimming motility by polyacrylamide gel electrophoresis, sequencing after purifying the stripe, and indicating that the animal food is contaminated by the bacterial toxin if the tRNACys -Tyr gene segment is inserted with insertion mutation of a basic group T at the 5238th and 5239th basic groups. The SSCP detecting method disclosed by the invention can be used for solving the defects of the conventional detecting method, and is quick, accurate, specific, sensitive, good in repeatability, low in detecting cost and easy for popularization and application.
Owner:YUNNAN AGRICULTURAL UNIVERSITY

Primer group for culturing homozygous black feather chicken and method for culturing homozygous black feather chicken

The invention provides a primer group for culturing homozygous black feather chicken and a method for culturing the homozygous black feather chicken by using the primer group. The primer group comprises a first primer group, a second primer group and a third primer group, wherein the first primer group is used for detecting whether an MC1R gene is mutated or not; the second primer group and the third primer group are used for detecting whether retrovirus is inserted into a TYR gene to cause a recessive white feather gene or not. The culturing method has the advantages that by using the first primer group, the second primer group and the third primer group, and simultaneously detecting the MC1R gene and the TYR gene, the EE (corresponding to the MC1R gene) and CC (corresponding to the TYR gene) gene type black feather chicken are screened out, and are homozygotes, and the recessive white feather gene is removed; the white feature individual will not occur in the filial generation when the primer group is matched with other systems, and the uniformity of the black feather phenotype is ensured; the breeding material of the breeding enterprise can be well protected on the basis of ensuring the product uniformity of the breeding enterprise.
Owner:SHANDONG AGRICULTURAL UNIVERSITY +1

Breeding method of albino paramisgurnus dabryanus capable of being inherited stably

The invention discloses a breeding method of albino paramisgurnus dabryanus capable of being inherited stably. The method comprises the steps as follows: a TYR (tyrosinase) gene target site is designed on a TYR gene sequence of paramisgurnus dabryanus, then an upstream primer and a downstream primer matched with the upstream primer are designed, PCR (polymerase chain reaction) amplification is performed with framework plasmid as a template, in-vitro transcription and purification are performed, and gRNA is obtained; Cas9 mRNA is obtained from linear Cas9 plasmid as a template after in-vitro transcription and purification; micro-injection is performed on fertilized eggs of the paramisgurnus dabryanus, the fertilized eggs are then incubated, gene knock-out fish is subjected to hybridization, and the albino paramisgurnus dabryanus capable of being inherited stably is obtained.
Owner:HUAZHONG AGRI UNIV

Primer for identifying recessive white feather and colored feather isozygoty of Xianglu mountain chickens and application of primer

The invention discloses a primer for identifying recessive white feather and colored feather isozygoty of Xianglu mountain chickens and application. Two pairs of primers, i.e., three primers, are adopted; two upstream primers are F1 and F2 respectively and one downstream primer is R; the upstream primer F1 and the downstream primer R are TYR gene ALV insertion sequence primers; the upstream primerF2 and the downstream primer R are TYR gene non-insertion sequence primers, wherein a primer sequence of the upstream primer F1 is as follows: 5'CGTTAAGCGAGACGGATGAGG 3'; a primer sequence of the upstream primer F2 is as follows: 5'AAGTTGTTGGAGGCTGGGTAT 3'; a primer sequence of the downstream primer R is as follows: 5'AGGCACAAGGAGTGGGACAGC 3'. The primer is used for identifying the recessive white feather and colored feather isozygoty of the Xianglu mountain chickens. The primer disclosed by the invention has the characteristic of rapidly and accurately identifying colored feather isozygoty and recessive homozygous individuals of the Xianglu mountain chickens.
Owner:GUIZHOU UNIV

Black rabbit hair color purification method based on genotype selection

The invention provides a black rabbit hair color purification method based on genotype selection. The purification method is suitable for purifying the hair color of various black rabbits such as meatrabbits, rex rabbits, long-hair rabbits, ornamental rabbits and experimental rabbits. The method includes the steps that rabbits with a black hair color phenotype are picked out; then, a first primergroup and a second primer group are used for detecting an MC1R gene and a TYR gene simultaneously, and black rabbits with the genotype being EDED (corresponding to the MC1R gene) and CC (corresponding to the TYR gene) are screened out. The obtained black rabbits are homozygous, recessive white genes are removed while EDEd heterozygotes are removed, and the double insurance of obtaining homozygousdominant black genes and removing recessive white genes is realized in breeding rabbit hair color selection. It can be guranateed that offspring are all black rabbits after the black rabbits obtainedthrough the method are mated with rabbits with other hair colors. The black rabbit specialized line cultured by the purification method can well protect the germplasm material of a breeding enterprise on the basis of ensuring the uniform hair color of commercial rabbits.
Owner:SHANDONG AGRICULTURAL UNIVERSITY

Skin gene detection method

The invention relates to a skin gene detection method. The method includes the following steps: S1, providing a detection sample of a detector, wherein the detection sample comprises a saliva sample;S2, extracting a nucleic acid sample of the saliva sample, performing SNP detection on 8 sites of 8 genes in the nucleic acid sample, wherein the 8 genes and sites respectively are rs13312741 site ofa TYR gene, rs1805007 site of an MC1R gene, rs11568737 site of an SLC45A2 gene, rs4880 site of an SOD2 gene, rs1799750 site of an MMP1 gene, rs222747 site of a TRPV1 gene, rs61816761 site of an FLG gene and rs11103631 site of an AQP3 gene; and S3, analyzing the detection results according to the data obtained in the S2, and determining the skin characteristic of the detector. The gene detection method can carry out characteristic detection on the skin at the gene level, can reflect the real condition of the skin of a detector, and can carry out skin care in a targeted way for a long time.
Owner:苏州罗塞塔生物科技有限公司

Expression cassette and expression vector of transgenic animal coat color report gene and application thereof

The invention relates to construction of an expression vector of a transgenic animal coat color report gene and application thereof. An expression cassette consists of two human TYR (tyrosinase) enhancers, a human TYR promoter, a mice TYR gene and bGH polyA which are successively connected in series; the sequence thereof is showed in SEQ ID NO. 13. The invention also discloses an expression vector comprising the expression cassette. The expression vector is transferred into a host animal genome with white coat color, and melanin sedimentation is generated after transgene expression. The coat color transformation can be directly observed with naked eye at the parts of skin, hair and the like of the host animal, and target gene expression situation is directly reflected. The vector constructed by the invention is applied to prepare transgenic mouse with mice as host animals, transgenic offspring is successfully obtained, and the coat color transformation can be observed, a black mouse is obtained, the vector is proved to be applied as a report gene.
Owner:YANGZHOU UNIV

Screening method for homozygous genotype agouti hair color rabbits

The invention provides a selecting method for domestic rabbits with a agouti / Belgian hair color based on homozygous genotype selection. The purification method is applicable to purification of various domestic rabbits with the agouti / Belgian hair color. The method includes the following steps: firstly, selecting the domestic rabbits with a hair color phenotype which is the agouti / Belgian hair color; then detecting an ASIP gene, a MC1R gene and a TYR gene at the same time by utilizing a first primer set, a second primer set and a third primer set; screening the domestic rabbits with genotypes of AA (corresponding to the ASIP gene), EE (corresponding to the MC1R gene) and CC (corresponding to the TYR gene). The domestic rabbits with the genotype of AAEECC, which are obtained by the screening method of the invention, are agouti / Belgian hair color homozygotes and the recessive white gene is eliminated.
Owner:SHANDONG AGRICULTURAL UNIVERSITY +1

Primer for identifying recessive white feather genotype of Xianglu mountain chickens and application of primer

The invention provides a primer for identifying recessive white feather genotype of Xianglu mountain chickens and an application of the primer. Two pairs of primers, i.e., three primers, are adopted through design; double PCR amplification are carried out on the TYR gene colored feather allele C and the white feather allele c, the amplified PCR product is electrophoresed on 1.2% agarose gel electrophoresis, and then the agarose gel is photographed by a gel-imaging system, and the obtained electrophoresis pattern result is subjected to genotype determination: if only a 169 bp band can be obtained, the allelotype of the chicken to be tested is cc-type recessive white feather homozygotic type; if only a 526 bp band can be obtained, the allelotype genotype of the test chicken is CC colored feather homozygotic type; and if both bands of 169 bp and 526 bp are obtained at the same time, the allelotype of the chicken to be tested is a Cc colored heterozygous type. The primer disclosed by the invention has the characteristic of rapidly and accurately identifying colored feather homozygotic type and recessive homozygotic type and heterozygosis individuals of the Xianglu mountain chickens.
Owner:GUIZHOU UNIV

Reconstructed eggs of albinism model pigs and its construction method and construction method of model pigs

The invention relates to a reconstructed ovum of an albinism model pig and a construction method thereof, and a construction method of the model pig. According to the construction method of the reconstructed ovum, tyrosinase is knocked out to obtain the reconstructed ovum of the albinism model pig. The combination of a CRISPP / Cas9 gene knock-out technique and a somatic nucleus transplantation technique proves that the method for constructing the gene modified pig has high feasibility. The obtained TYR gene knock-out pig has the typical characteristics of albinism, can provide a reliable animal model for researching human albinism, can be applied to toxicity and anaphylaxis detection and many other aspects, and is hopeful to become a standardized experimental animal for albinism-like mice.
Owner:广州中科飞豚生物科技有限责任公司

Mutated tyr gene associated with oculocutaneous albinism type 1 and its use in genetic diagnosis

The invention discloses a mutated TYR gene related to oculocutaneous albinism type 1 and its application in gene diagnosis. The present invention judges that the disease is transmitted in an autosomal recessive manner by collecting a 4-generation oculocutaneous albinism type 1 pedigree. By reading the literature and online databases, select candidate genes that may cause the disease, and then perform PCR amplification and Sanger sequencing on the proband and other family members to confirm the mutation gene site. Among them, the TYR pathogenic gene mutation c.107G>C was found to be a new pathogenic mutation. The discovery of this new TYR pathogenic gene mutation site enriches the spectrum of pathogenic gene mutations and can be used as a screening site for prenatal diagnosis of oculocutaneous albinism type 1, a serious recessive genetic disease, for the eugenics of the population Excellent education guidance. The proposal of the present invention provides data support for the development of the design of the prenatal diagnostic chip for this mutation type, and is especially important for the prenatal genetic diagnosis screening of serious harm rare genetic diseases.
Owner:HARBIN MEDICAL UNIVERSITY

A molecular identification method of chicken recessive white feather gene

The invention belongs to the technical field of chicken molecular marker preparation. Specifically, the invention relates to a molecular identification method of a chicken recessive white feather gene. A molecular identification method for the chicken recessive white feather gene was established, and primer pair 1 and primer pair 2, wherein primer pair 1 is used to detect recessive white feather alleles, and primer pair 2 is used to detect colored feather alleles. The method is: extract the genomic DNA of the chicken to be identified, perform PCR amplification with primer pair 1 and primer pair 2; detect the amplified product by electrophoresis; judge the feather color genotype of the chicken according to the electrophoresis result: if only primer pair 1 amplifies the product , it is a recessive white feather homozygote (the phenotype is white feather); if only primer pair 2 amplifies the product, it is a non-recessive white feather homozygote (the phenotype may be colored or white feather); if both pairs of primers can amplify If the product is produced, it is a recessive white feather heterozygote (the phenotype may be colored or white feather). The invention provides a fast method for identifying the chicken recessive white feather genotype.
Owner:HUAZHONG AGRI UNIV

Method for constructing albino hamster model based on CRISPR-Cas9 system

The invention belongs to the field of gene engineering, and particularly relates to a method for constructing an albino hamster model based on a CRISPR-Cas9 system. The method for constructing the albino hamster model based on the CRISPR-Cas9 system comprises the following steps: determining a hamster TRY gene targeting site sequence; preparing gRNA (guide ribonucleic acid); performing in-vitro microinjection: collecting fertilized eggs of the hamster, injecting the gRNA and Cas9 RNA into the fertilized eggs of the hamster, and transplanting and cultivating the injected fertilized eggs. The sgRNA of the specific targeting hamster TRY gene prepared by the invention can accurately target a hamster TYR gene and realize gene knockout, and an albino hamster with TYR gene deletion is produced.
Owner:辽宁长生生物技术股份有限公司

Application of a skin color-related SNP marker in silky chicken genotyping

The invention provides an application of a skin color-associated SNP marker in genotyping of black-bone chickens. The SNP marker is located at 2228 bp upstream of a transcription initiation site in apromoter region of a TYR gene, and a base with polymorphism is adenine A or thymine T. The SNP genotype detection primer has high specificity, single detection band and accurate typing results. In combination with a provided detection method, the whole operation process is simpler and more efficient, and the cost is lower. Rapid and accurate individual screening is achieved, and a basis for breeding development and protection of black-bone chicken varieties is provided.
Owner:LESHAN NORMAL UNIV

Contains siRNA cell culture whitening essence that inhibits melanin production

The invention discloses a whitening essence containing an siRNA (Small Interfering Ribose Nucleic Acid) cell culture for inhibiting generation of melanin. The whitening essence is prepared from an epidermal cell culture fluid, contains the siRNA used for inhibiting the expression of tyrosinase (Tyr) and is used for interdicting the generation of the melanin in skin tissue melanin cells. With the adoption of the whitening essence, the siRNA is coated by lipidosome, enters a skin and is used for exerting the gene inhibition action; and as the epidermal cell culture fluid is rich in growth factors, amino acid and vitamins excreted by epidermal cells, and cell growth factors with a definite content, glycerinum and hyaluronic acid are added, the moisturizing effect of the whitening essence is added. A method of preparing the whitening essence comprises the steps: designing a synthetic siRNA aiming at a tyr gene, preparing an siRNA-lipidosome compound, acquiring an umbilical cord tissue epidermis of a newborn, collecting the cell culture fluid, filtering, concentrating and adding an active component. The whitening essence is used for interdicting the generation of the melanin from the molecular level, provides multiple endogenous nutritional ingredients with the physiological activity for the skin and has the moisturizing effect.
Owner:奥思达干细胞有限公司

sgRNA guide sequence of specific targeting mouse Tyr gene and application thereof

The invention discloses an sgRNA guide sequence of a specific targeting mouse Tyr gene and an application thereof, which belong to the technical field of medical genetics and molecular biology. A nucleotide sequence corresponding to the sgRNA is any one of SEQ ID NO. 1, SEQ ID NO. 2 and SEQ ID NO. 3. The invention also discloses a method for editing the mouse Tyr gene by utilizing the sgRNA guidesequence of the specific targeting mouse Tyr gene. The sgRNA guide sequence disclosed by the invention can mediate Cas9 protein to efficiently cut target DNA, so that the sgRNA guide sequence is usedfor editing the Tyr gene of a mouse to influence the function of the Tyr gene encoding protein of the mouse. According to the sgRNA guide sequence, efficient targeting can be achieved through a CRISPR / Cas9 system, and the efficiency is 100%.
Owner:GUILIN MEDICAL UNIVERSITY

Primer, kit and detection method for detecting recessive white feather locus genotype of chicken

The invention discloses a primer, a kit and a detection method for detecting a recessive white feather locus genotype of a chicken, belonging to the technical field of biology. According to the invention, a specific primer P1 of an allelic gene c is designed according to the fact that 7.7kb insertion (ev1) exists in a fourth intron of a TYR gene, a specific primer P2 of the allelic gene c is designed according to the fact that 7.7kb insertion (ev1) does not exist in a fourth intron of a PMEL17 gene, a primer P3 is a common downstream primer of the primer P1 and the primer P2, a whole genome of a to-be-detected chicken containing the TYR gene is taken as a template, the primers P1, P2 and P3 are put in the same PCR (Polymerase Chain Reaction), an amplified fragment of the PCR is subjected to agarose gel electrophoresis after once PCR, and the recessive white feather locus genotype of the TYR gene of the chicken is identified according to the result of the agarose gel electrophoresis. The method greatly improves the genotype judging efficiency and accuracy, the method is simple, the genotype judging time is short, no sequencing or restriction enzyme is needed, no special instrument is required, the cost is low, and the method is easy to popularize.
Owner:HENAN AGRICULTURAL UNIVERSITY

Hair-related gene locus library and application method thereof

The invention belongs to the technical field of gene detection, and provides a hair-related gene locus library and an application method thereof. The gene locus library comprises SRD5A2 gene, 2-V89L gene, AR gene, DHT gene, FGF-5 gene, MAPK gene, HIF gene, BCMO 1 gene, SELL gene, DDB2 gene, IL-6 gene, TNF-alpha gene, Edar gene, VDR gene, CYP 450 gene, DAG gene, MCR1 gene, XRC1 gene, ERCC2 gene, KITLG gene, TYR gene, TYRP1 gene, OCA2 gene, Wnt gene and Beta-catenin gene. The locus library is comprehensive and reflects the root cause of hair problems from a gene level. Setting scores of polymorphic loci can simply evaluate the hair state, the evaluation result is accurate, and a scheme for personalized hair care is provided.
Owner:江颖纯

Specific primer and liquid phase chip for detecting TYR gene mutation

The invention discloses a liquid phase chip and a specific primer for detecting TYR gene mutation. The liquid phase chip mainly comprises: ASPE primers, microspheres coated by different anti-tag sequences, and an amplification primer, wherein each ASPE primer is composed of a tag sequence at a 5' end and specific primer sequences at a 3' end and aiming at target gene mutation sites, and the specific primer sequences are as follows: SEQ ID NO.9 and SEQ ID NO.10 aiming at a G6895A site, SEQ ID NO.11 and SEQ ID NO.12 aiming at an C1205T site, SEQ ID NO.13 and SEQ ID NO.14 aiming at a C575A site, and / or SEQ ID NO.15 and SEQ ID NO.16 aiming at an A99214C site. The coincidence rate of the detection result of the detection liquid phase chip disclosed by the invention with that of a sequencing method reaches as high as 100%, and parallel detection of a wild type and a mutant of a plurality of mutation sites is achieved.
Owner:SUREXAM BIO TECH

A method for purifying black rabbit coat color based on genotype selection

The invention provides a black rabbit hair color purification method based on genotype selection. The purification method is suitable for purifying the hair color of various black rabbits such as meatrabbits, rex rabbits, long-hair rabbits, ornamental rabbits and experimental rabbits. The method includes the steps that rabbits with a black hair color phenotype are picked out; then, a first primergroup and a second primer group are used for detecting an MC1R gene and a TYR gene simultaneously, and black rabbits with the genotype being EDED (corresponding to the MC1R gene) and CC (corresponding to the TYR gene) are screened out. The obtained black rabbits are homozygous, recessive white genes are removed while EDEd heterozygotes are removed, and the double insurance of obtaining homozygousdominant black genes and removing recessive white genes is realized in breeding rabbit hair color selection. It can be guranateed that offspring are all black rabbits after the black rabbits obtainedthrough the method are mated with rabbits with other hair colors. The black rabbit specialized line cultured by the purification method can well protect the germplasm material of a breeding enterprise on the basis of ensuring the uniform hair color of commercial rabbits.
Owner:SHANDONG AGRICULTURAL UNIVERSITY