Primer for identifying recessive white feather genotype of Xianglu mountain chickens and application of primer
A technique of recessive white feather and genotyping, applied in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc., can solve the problem of loss of normal functional activity of tyrosinase, inability to synthesize melanin, and inability to transcribe normally And other issues
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] Example 1: A primer for identifying the recessive white feather genotype of Xianglu pheasant, the primers are 2 pairs of 3 primers, one upstream primer F, and two downstream primers R respectively 1 , R 2 , upstream primer F and downstream primer R 1 There is ALV insertion sequence primer for TYR gene, upstream primer F and downstream primer R 2 There is no insert sequence primer for TYR gene, wherein, the primer sequence of the upstream primer F is: 5' GGGAAACTTTAAGGACTGGTGGA 3', the downstream primer R 1 The primer sequence is: 5'CTGGGTAGATGGACAGACCGTTG 3'; downstream primer R 2 The primer sequence is: 5'CAAGAGGCACAAGGAGTGGGACA3'.
[0024] The application of the above-mentioned primers for identifying the recessive white feather genotype of Xianglu pheasant is used to identify homozygous recessive white feathers and homozygous colored feathers of Xianglu pheasant, and the application method includes the following steps:
[0025] 1) Using the genomic DNA of the chi...
Embodiment 2
[0028] Example 2: A primer for identifying the recessive white feather genotype of Xianglu pheasant, the primers are 2 pairs of 3 primers, one upstream primer is F, and the two downstream primers are R respectively 1 , R 2 , upstream primer F and downstream primer R 1 There is ALV insertion sequence primer for TYR gene, upstream primer F and downstream primer R 2 There is no insert sequence primer for TYR gene, wherein, the primer sequence of the upstream primer F is: 5' GGGAAACTTTAAGGACTGGTGGA 3', the downstream primer R 1 The primer sequence is: 5'CTGGGTAGATGGACAGACCGTTG 3'; downstream primer R 2 The primer sequence is: 5'CAAGAGGCACAAGGAGTGGGACA3'.
[0029]The application of the above-mentioned primers for identifying the recessive white feather genotype of Xianglu pheasant is used to identify homozygous recessive white feathers and homozygous colored feathers of Xianglu pheasant, and the application method includes the following steps:
[0030] 1) Using the genomic DNA ...
Embodiment 3
[0033] Example 3: A primer for identifying the recessive white feather genotype of Xianglu pheasant, the primers are 2 pairs of 3 primers, one upstream primer is F, and the two downstream primers are R respectively 1 , R 2 , upstream primer F and downstream primer R 1 There is ALV insertion sequence primer for TYR gene, upstream primer F and downstream primer R 2 There is no insert sequence primer for TYR gene, wherein, the primer sequence of the upstream primer F is: 5' GGGAAACTTTAAGGACTGGTGGA 3', the downstream primer R 1 The primer sequence is: 5'CTGGGTAGATGGACAGACCGTTG 3'; downstream primer R 2 The primer sequence is: 5'CAAGAGGCACAAGGAGTGGGACA3'.
[0034] The application of the above-mentioned primers for identifying the recessive white feather genotype of Xianglu pheasant is used to identify homozygous recessive white feathers and homozygous colored feathers of Xianglu pheasant, and the application method includes the following steps:
[0035] 1) Using the genomic DNA...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap