Primer for identifying recessive white feather genotype of Xianglu mountain chickens and application of primer

A technique of recessive white feather and genotyping, applied in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc., can solve the problem of loss of normal functional activity of tyrosinase, inability to synthesize melanin, and inability to transcribe normally And other issues

Pending Publication Date: 2019-04-19
GUIZHOU UNIV
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The molecular mechanism of recessive white feather formation is: the formation of recessive white feather is due to the insertion of a 7.7kp endogenous leukemia virus ALV sequence in the fourth intron region of TYR (tyrosinase gene), resulting in TYR gene transcripts The transmembrane domain lacking the fifth exon in the
As a result, tyrosinase loses its normal functional activity, resulting in the inability to synthesize melanin, resulting in the formation of chicken white feathers

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer for identifying recessive white feather genotype of Xianglu mountain chickens and application of primer
  • Primer for identifying recessive white feather genotype of Xianglu mountain chickens and application of primer
  • Primer for identifying recessive white feather genotype of Xianglu mountain chickens and application of primer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1: A primer for identifying the recessive white feather genotype of Xianglu pheasant, the primers are 2 pairs of 3 primers, one upstream primer F, and two downstream primers R respectively 1 , R 2 , upstream primer F and downstream primer R 1 There is ALV insertion sequence primer for TYR gene, upstream primer F and downstream primer R 2 There is no insert sequence primer for TYR gene, wherein, the primer sequence of the upstream primer F is: 5' GGGAAACTTTAAGGACTGGTGGA 3', the downstream primer R 1 The primer sequence is: 5'CTGGGTAGATGGACAGACCGTTG 3'; downstream primer R 2 The primer sequence is: 5'CAAGAGGCACAAGGAGTGGGACA3'.

[0024] The application of the above-mentioned primers for identifying the recessive white feather genotype of Xianglu pheasant is used to identify homozygous recessive white feathers and homozygous colored feathers of Xianglu pheasant, and the application method includes the following steps:

[0025] 1) Using the genomic DNA of the chi...

Embodiment 2

[0028] Example 2: A primer for identifying the recessive white feather genotype of Xianglu pheasant, the primers are 2 pairs of 3 primers, one upstream primer is F, and the two downstream primers are R respectively 1 , R 2 , upstream primer F and downstream primer R 1 There is ALV insertion sequence primer for TYR gene, upstream primer F and downstream primer R 2 There is no insert sequence primer for TYR gene, wherein, the primer sequence of the upstream primer F is: 5' GGGAAACTTTAAGGACTGGTGGA 3', the downstream primer R 1 The primer sequence is: 5'CTGGGTAGATGGACAGACCGTTG 3'; downstream primer R 2 The primer sequence is: 5'CAAGAGGCACAAGGAGTGGGACA3'.

[0029]The application of the above-mentioned primers for identifying the recessive white feather genotype of Xianglu pheasant is used to identify homozygous recessive white feathers and homozygous colored feathers of Xianglu pheasant, and the application method includes the following steps:

[0030] 1) Using the genomic DNA ...

Embodiment 3

[0033] Example 3: A primer for identifying the recessive white feather genotype of Xianglu pheasant, the primers are 2 pairs of 3 primers, one upstream primer is F, and the two downstream primers are R respectively 1 , R 2 , upstream primer F and downstream primer R 1 There is ALV insertion sequence primer for TYR gene, upstream primer F and downstream primer R 2 There is no insert sequence primer for TYR gene, wherein, the primer sequence of the upstream primer F is: 5' GGGAAACTTTAAGGACTGGTGGA 3', the downstream primer R 1 The primer sequence is: 5'CTGGGTAGATGGACAGACCGTTG 3'; downstream primer R 2 The primer sequence is: 5'CAAGAGGCACAAGGAGTGGGACA3'.

[0034] The application of the above-mentioned primers for identifying the recessive white feather genotype of Xianglu pheasant is used to identify homozygous recessive white feathers and homozygous colored feathers of Xianglu pheasant, and the application method includes the following steps:

[0035] 1) Using the genomic DNA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a primer for identifying recessive white feather genotype of Xianglu mountain chickens and an application of the primer. Two pairs of primers, i.e., three primers, are adopted through design; double PCR amplification are carried out on the TYR gene colored feather allele C and the white feather allele c, the amplified PCR product is electrophoresed on 1.2% agarose gel electrophoresis, and then the agarose gel is photographed by a gel-imaging system, and the obtained electrophoresis pattern result is subjected to genotype determination: if only a 169 bp band can be obtained, the allelotype of the chicken to be tested is cc-type recessive white feather homozygotic type; if only a 526 bp band can be obtained, the allelotype genotype of the test chicken is CC colored feather homozygotic type; and if both bands of 169 bp and 526 bp are obtained at the same time, the allelotype of the chicken to be tested is a Cc colored heterozygous type. The primer disclosed by the invention has the characteristic of rapidly and accurately identifying colored feather homozygotic type and recessive homozygotic type and heterozygosis individuals of the Xianglu mountain chickens.

Description

technical field [0001] The invention relates to the technical field of gene molecular identification in molecular genetics, and relates to a primer for identifying the recessive white feather genotype of Xianglu pheasant and its application. Background technique [0002] The Xianglu pheasant is a primitive chicken breed formed under the long-term closed natural conditions of the Xianglu Mountain after the Miao people in the Kaili area migrated from the Central Plains to the southwest. The main wing feathers of the hen have flaky black feathers, and the tail has black feathers. Most of the feathers are sunflower-shaped. The back feathers of the rooster are brownish red, and the tail feathers are black with green luster. In Xianglu pheasant breeding, about 2 / 1000 white-feathered chickens appeared in the population. It was found that the recessive white-feathered allele would cause white spots on the feathers of chickens, resulting in a large proportion of elimination in breedi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6888C12Q1/6858C12N15/11
CPCC12Q1/6858C12Q1/6888C12Q2600/124C12Q2600/156C12Q2600/16C12Q2531/113C12Q2537/143C12Q2565/125
Inventor 李辉李兴才彭邦星杨华婷陈林赵忠海师新彩
Owner GUIZHOU UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products