Molecular marker closely linked with major QTL of wheat height and uppermost internode length as well as acquisition method and application of molecular marker
A technology for molecular markers and acquisition methods, which is applied in biochemical equipment and methods, microbial measurement/inspection, DNA preparation, etc., can solve problems such as molecular markers, achieve fast and accurate screening, improve selection efficiency and quality, and accelerate The effect of the selection process
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Molecular markers closely linked to wheat plant height and subpanicle internode length major QTL,
[0033] labeled primers Xcnl10 ,
[0034] Upstream primer sequence: CTTACCTAGTACAATGTACTCTCTCT (as described in SEQ ID NO: 1),
[0035] Downstream primer sequence: ATGATGGTCTGGATCTGG (as described in SEQ ID NO: 2);
[0036] Carry out PCR amplification on the DNA of wheat variety Kenon 9204, and the PCR amplification system is 20 μl, including: 1 μl of DNA template, 1 μl of upstream primer, 1 μl of downstream primer, 10 μl of 2×Taq PCR StarMix, 7 μl ddH 2 O: Gradient descent PCR amplification program was adopted, and the steps were as follows: first, denaturation at 94°C for 4 min, followed by 15 cycles of annealing temperature drop program, each cycle was denaturation at 94°C for 45 s, renaturation at 65°C for 50 s, and each cycle was For the first cycle, lower 1°C from 65°C, and extend at 72°C for 55 s; carry out another 30 cycles of common PCR program, namely: denatu...
Embodiment 2
[0052] The application of the molecular markers closely linked to the major QTLs of wheat plant height and internode length under panicle provided by the present invention in 574 semi-dwarf derivative varieties (lines) of wheat line Kenong 9204 as parents.
[0053] 574 Kenong 9204 semi-dwarf derivative varieties (lines) were used to verify the application of molecular markers for the tight linkage of major QTLs for plant height and internode length under panicle. The specific steps are as follows:
[0054] (1) 574 Kenong 9204 semi-dwarf derivative varieties (lines) were planted in the field, and the leaves of the plants of each line were isolated and extracted using the improved CTAB method;
[0055] The 574 Kenong 9204 semi-dwarf derivative varieties (lines) and their pedigrees are shown in Table 2. With Kenong 9204 as the parent, they were propagated to F 2 A new wheat variety or line obtained through line selection based on the comprehensive performance of plant height and...
Embodiment 3
[0066] Molecular markers closely linked to main gene loci of wheat plant height and internode length under panicle provided by the present invention Xcnl10 F 6 The 41 derived lines of the generation RIL population and the application in Kenon 9204 and Jing 411.
[0067] With Kenong 9204 as the female parent and Jing 411 as the male parent, the F7 recombinant inbred line population (RIL population) was constructed by the single seed transmission method (SSD method). labeled primers Xcnl10 Jing 411, Ke Nong 9204 and 41 derivative lines were analyzed. The specific steps are as follows:
[0068] (1) Plant the wheat varieties Kenong 9204, Jing 411 and 41 derivative lines in the field, and use the SDS method to separate and extract DNA from the leaves of the plants of each line; the derivative lines of Kenong 9204 refer to: Nong 9204 was used as the female parent, and Jing 411 was used as the male parent, and the strain was obtained by single-seed transmission method;
[0069] ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap