Molecular marker closely linked with major QTL of wheat height and uppermost internode length as well as acquisition method and application of molecular marker

A technology for molecular markers and acquisition methods, which is applied in biochemical equipment and methods, microbial measurement/inspection, DNA preparation, etc., can solve problems such as molecular markers, achieve fast and accurate screening, improve selection efficiency and quality, and accelerate The effect of the selection process

Inactive Publication Date: 2015-02-25
INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
View PDF5 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no report on the molecular markers that have been named and closely linked to the 4BL dwarf gene and the internode length under the panicle

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker closely linked with major QTL of wheat height and uppermost internode length as well as acquisition method and application of molecular marker
  • Molecular marker closely linked with major QTL of wheat height and uppermost internode length as well as acquisition method and application of molecular marker
  • Molecular marker closely linked with major QTL of wheat height and uppermost internode length as well as acquisition method and application of molecular marker

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Molecular markers closely linked to wheat plant height and subpanicle internode length major QTL,

[0033] labeled primers Xcnl10 ,

[0034] Upstream primer sequence: CTTACCTAGTACAATGTACTCTCTCT (as described in SEQ ID NO: 1),

[0035] Downstream primer sequence: ATGATGGTCTGGATCTGG (as described in SEQ ID NO: 2);

[0036] Carry out PCR amplification on the DNA of wheat variety Kenon 9204, and the PCR amplification system is 20 μl, including: 1 μl of DNA template, 1 μl of upstream primer, 1 μl of downstream primer, 10 μl of 2×Taq PCR StarMix, 7 μl ddH 2 O: Gradient descent PCR amplification program was adopted, and the steps were as follows: first, denaturation at 94°C for 4 min, followed by 15 cycles of annealing temperature drop program, each cycle was denaturation at 94°C for 45 s, renaturation at 65°C for 50 s, and each cycle was For the first cycle, lower 1°C from 65°C, and extend at 72°C for 55 s; carry out another 30 cycles of common PCR program, namely: denatu...

Embodiment 2

[0052] The application of the molecular markers closely linked to the major QTLs of wheat plant height and internode length under panicle provided by the present invention in 574 semi-dwarf derivative varieties (lines) of wheat line Kenong 9204 as parents.

[0053] 574 Kenong 9204 semi-dwarf derivative varieties (lines) were used to verify the application of molecular markers for the tight linkage of major QTLs for plant height and internode length under panicle. The specific steps are as follows:

[0054] (1) 574 Kenong 9204 semi-dwarf derivative varieties (lines) were planted in the field, and the leaves of the plants of each line were isolated and extracted using the improved CTAB method;

[0055] The 574 Kenong 9204 semi-dwarf derivative varieties (lines) and their pedigrees are shown in Table 2. With Kenong 9204 as the parent, they were propagated to F 2 A new wheat variety or line obtained through line selection based on the comprehensive performance of plant height and...

Embodiment 3

[0066] Molecular markers closely linked to main gene loci of wheat plant height and internode length under panicle provided by the present invention Xcnl10 F 6 The 41 derived lines of the generation RIL population and the application in Kenon 9204 and Jing 411.

[0067] With Kenong 9204 as the female parent and Jing 411 as the male parent, the F7 recombinant inbred line population (RIL population) was constructed by the single seed transmission method (SSD method). labeled primers Xcnl10 Jing 411, Ke Nong 9204 and 41 derivative lines were analyzed. The specific steps are as follows:

[0068] (1) Plant the wheat varieties Kenong 9204, Jing 411 and 41 derivative lines in the field, and use the SDS method to separate and extract DNA from the leaves of the plants of each line; the derivative lines of Kenong 9204 refer to: Nong 9204 was used as the female parent, and Jing 411 was used as the male parent, and the strain was obtained by single-seed transmission method;

[0069] ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a molecular marker closely linked with the major QTL of wheat height and uppermost internode length as well as an acquisition method and application of the molecular marker. The acquisition method comprises the following steps: carrying out PCR amplification on DNA of a wheat variety Kenong9204 by adopting a marked primer Xcnl10; carrying out electrophoretic separation on the amplified product on 6.0% native polyacrylamide gel to obtain the amplified product with molecular weight of 700bp, namely the molecular marker of major QTL of wheat height and uppermost internode length. The molecular marker can be used for detecting whether a wheat variety or line contains QTL capable of reducing plant height and uppermost internode length, or not, so that the wheat variety or line containing QTL capable of reducing the plant height and uppermost internode length can be quickly screened for breeding, and the breeding progress for excellent wheat plant variety can be greatly accelerated.

Description

technical field [0001] The invention relates to the application field of wheat molecular biotechnology and breeding, in particular to a molecular marker closely linked to main QTLs of wheat plant height and sub-panicle internode length and its acquisition method and application. Background technique [0002] Wheat plant height is closely related to lodging resistance, which is an important trait affecting high and stable yield of wheat. Reducing plant height and improving lodging resistance have always been important goals of wheat high-yield breeding. The plant height of wheat is controlled by polygenes or a few major genes plus a series of minor genes or modifier genes, showing typical quantitative trait inheritance characteristics. Many scholars at home and abroad have studied the genetic mechanism of wheat plant height, and many QTLs for plant height have been located almost all over the 21 chromosomes of wheat. Since the world's first "green revolution" initiated by D...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/11C12N15/10C12Q1/68
Inventor崔法李俊明纪军张伟樊小莉赵春华
OwnerINST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI