Probe for classificatory diagnosis of four plasmodia infecting human, kit and using method thereof
A Plasmodium and kit technology, applied in the field of diagnosing Plasmodium falciparum, Plasmodium malariae probes, Plasmodium ovale, and Plasmodium vivax, can solve laborious and time-consuming problems
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0038] 1. Test materials and methods
[0039] 1.1 Test material
[0040] Four kinds of Plasmodium artificially synthesized fragments were artificially synthesized with reference to the published sequences on Genbank (M19172, AF488000, L48987, X13926). The fragments were connected to the pMD18-T vector and transformed into competent cells DH5α, with 30% glycerol Stored in liquid form.
[0041] Synthetic plasmids and genomic DNA from clinical samples were provided by Beijing Inspection and Quarantine Bureau.
[0042] 1.2 Probe design
[0043] The DNAMAN software was used to compare the amplified fragments of the four general upstream and downstream primers of Plasmodium (5'-3': GAGGGCAAGTCTGGTGCCAG, 5'-3': CATCTGAATACGAATGTCCCCAAGC), and select the differential sequences to design four types of Plasmodium detection probes. Needles (SEQ No.1-SEQ No.4), primers and probes were synthesized by Invitrogen, the 5' end of the primer was labeled with biotin, 10 T tails were added to ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
