Probe for classificatory diagnosis of four plasmodia infecting human, kit and using method thereof

A Plasmodium and kit technology, applied in the field of diagnosing Plasmodium falciparum, Plasmodium malariae probes, Plasmodium ovale, and Plasmodium vivax, can solve laborious and time-consuming problems

Active Publication Date: 2015-03-25
CHINA INSPECTION LAB TECH CO LTD
View PDF3 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the PCR method is still labor-intensive and time-con

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Probe for classificatory diagnosis of four plasmodia infecting human, kit and using method thereof
  • Probe for classificatory diagnosis of four plasmodia infecting human, kit and using method thereof
  • Probe for classificatory diagnosis of four plasmodia infecting human, kit and using method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0038] 1. Test materials and methods

[0039] 1.1 Test material

[0040] Four kinds of Plasmodium artificially synthesized fragments were artificially synthesized with reference to the published sequences on Genbank (M19172, AF488000, L48987, X13926). The fragments were connected to the pMD18-T vector and transformed into competent cells DH5α, with 30% glycerol Stored in liquid form.

[0041] Synthetic plasmids and genomic DNA from clinical samples were provided by Beijing Inspection and Quarantine Bureau.

[0042] 1.2 Probe design

[0043] The DNAMAN software was used to compare the amplified fragments of the four general upstream and downstream primers of Plasmodium (5'-3': GAGGGCAAGTCTGGTGCCAG, 5'-3': CATCTGAATACGAATGTCCCCAAGC), and select the differential sequences to design four types of Plasmodium detection probes. Needles (SEQ No.1-SEQ No.4), primers and probes were synthesized by Invitrogen, the 5' end of the primer was labeled with biotin, 10 T tails were added to ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a probe for classificatory diagnosis of four plasmodia infecting human, a kit and a using method thereof, wherein species special probes are respectively adopted for plasmodium falciparum, plasmodium vivax, plasmodium ovale and plasmodium malariae; 10 T tails are added at the 5' end of the probe and are cross-linked and fixed on a nylon hybrid membrane in an ultraviolet manner. The kit consists of PCR and reverse dot blot hybridization reaction reagents and materials and can be used for classificatory diagnosis of plasmodium falciparum, plasmodium vivax, plasmodium ovale and plasmodium malariae or two or three or four of the plasmodium falciparum, plasmodium vivax, plasmodium ovale and plasmodium malaria, so that the invention provides a simple, convenient and quick plasmodium classificatory diagnosis technique.

Description

technical field [0001] The present invention relates to a probe, a kit and a use method thereof for the typing diagnosis of Plasmodium, in particular to a probe for diagnosing Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale and Plasmodium malariae. The needle and its kit and application method belong to the field of malaria parasite detection. Background technique [0002] Plasmodium is a general term for a genus in the phylum Protozoa, class Sporozoa, order Cocciidea, suborder Haemosporidiidea, and family Plasmadiidea, that is, the genus Plasmodium. Those that parasitize the human body include four types: Plasmodium falciparum, Plasmodium vivax, Plasmodium ovals, and Plasmodium malariae. In my country, malaria vivax is the most widely distributed, except for the Qinghai-Tibet Plateau, throughout the country. Plasmodium falciparum is next, distributed in the south of the Qinling Mountains and Huaihe River, especially in Yunnan, Guizhou, Guangdong, Guangxi and Hai...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/68C12Q1/04C12R1/90
CPCC12Q1/6834C12Q1/6893C12Q2531/113C12Q2525/173Y02A50/30
Inventor 邹明强薛强殷宏王飞刘翌马吉湘
Owner CHINA INSPECTION LAB TECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap