Recessive white feather Beijing fatty chicken breeding method
A technology of recessive white feathers and breeding methods, which is applied in the field of poultry genetics and breeding, can solve the problems of reduced chicken quality and flavor, and achieve the effects of beautiful carcass, good quality meat and eggs, and fast growth
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Example 1 Breeding process of recessive white-feathered Peking chicken
[0032] In 2005, the Animal Husbandry and Veterinary Research Institute of Beijing Academy of Agriculture and Forestry Sciences crossed the purebred Beijing oil chicken with the characteristics of crested head, beard, hairy legs, and five toes with the hens in the population of recessive white feathers introduced from abroad to breed recessive white feathers Peking oil chicken. Concrete cultivation method comprises the following steps:
[0033] (1) Crossbreed the hen of the purebred Peking oil chicken with the characteristics of crested head, beard, hairy legs and five toes with the recessive white feather rooster introduced from abroad to obtain F 1 generation;
[0034] (2) F will be obtained 1 Hen crosses rooster, gets F 2 generation;
[0035] (3) From F 2 High-quality white-feathered hens were selected from the generation, and they were backcrossed with purebred Beijing Youji cocks with the...
experiment example 1
[0048] Experimental example 1 Determination of performance of recessive white feather Beijing oil chicken
[0049] In 2014, the appearance, growth, meat and egg quality and other performance registration and measurement of the recessive white-feathered Beijing oil chicken population cultivated by the present invention were carried out, and the results are as follows.
[0050] 1. Appearance
[0051] At the age of 12 weeks, the appearance of the existing recessive white-feathered Beijing oil chicken population was registered, and the statistical results are shown in Table 3.
[0052] Table 3 Appearance statistics of recessive white-feathered Peking chicken
[0053]
[0054] Both the crested head and hairy legs are 100%, the proportion of beards reaches 90%, and the proportion of five toes reaches 98%.
[0055] 2. Weight
[0056] At the age of 10-16 weeks, the recessive white-feathered Beijing oil chickens were weighed every two weekends (after 12 hours of fasting), and the...
experiment example 2
[0072] Experimental Example 2 Molecular Detection of Recessive White Feather Peking Chicken
[0073] Sato et al. in 2007 confirmed that a 7.7kb insertion in the fourth intron of tyrosinase (TYR) was the direct cause of the recessive white feather trait. Referring to the report of Xu Jiguo et al. in 2011, three pairs of primers were designed:
[0074] Forward primer F1: CCTCTGGCTCTATTTGACTACACAGT,
[0075] Forward primer F2: CAAAACCATAAATAGCACTGGAAATAG,
[0076] Reverse primer R: TTGAGATACTGGAGGTCTTTAGAAATG.
[0077] The mutation can be typed by 2% agarose detection after PCR amplification. If the product has only one 481bp fragment, the individual is homozygous for colored feathers; if there is only one 345bp fragment, it is homozygous for recessive white feather; if two fragments (345bp, 481bp) appear at the same time, the individual is heterozygous for colored feathers. See image 3 :
[0078] Lanes 1-3 are recessive white feather homozygotes;
[0079] Lanes 4-6 are h...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
