Check patentability & draft patents in minutes with Patsnap Eureka AI!

Recessive white feather Beijing fatty chicken breeding method

A technology of recessive white feathers and breeding methods, which is applied in the field of poultry genetics and breeding, can solve the problems of reduced chicken quality and flavor, and achieve the effects of beautiful carcass, good quality meat and eggs, and fast growth

Inactive Publication Date: 2015-05-13
BEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES
View PDF3 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this method often results in a significant reduction in the quality and flavor of local chicken

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recessive white feather Beijing fatty chicken breeding method
  • Recessive white feather Beijing fatty chicken breeding method
  • Recessive white feather Beijing fatty chicken breeding method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1 Breeding process of recessive white-feathered Peking chicken

[0032] In 2005, the Animal Husbandry and Veterinary Research Institute of Beijing Academy of Agriculture and Forestry Sciences crossed the purebred Beijing oil chicken with the characteristics of crested head, beard, hairy legs, and five toes with the hens in the population of recessive white feathers introduced from abroad to breed recessive white feathers Peking oil chicken. Concrete cultivation method comprises the following steps:

[0033] (1) Crossbreed the hen of the purebred Peking oil chicken with the characteristics of crested head, beard, hairy legs and five toes with the recessive white feather rooster introduced from abroad to obtain F 1 generation;

[0034] (2) F will be obtained 1 Hen crosses rooster, gets F 2 generation;

[0035] (3) From F 2 High-quality white-feathered hens were selected from the generation, and they were backcrossed with purebred Beijing Youji cocks with the...

experiment example 1

[0048] Experimental example 1 Determination of performance of recessive white feather Beijing oil chicken

[0049] In 2014, the appearance, growth, meat and egg quality and other performance registration and measurement of the recessive white-feathered Beijing oil chicken population cultivated by the present invention were carried out, and the results are as follows.

[0050] 1. Appearance

[0051] At the age of 12 weeks, the appearance of the existing recessive white-feathered Beijing oil chicken population was registered, and the statistical results are shown in Table 3.

[0052] Table 3 Appearance statistics of recessive white-feathered Peking chicken

[0053]

[0054] Both the crested head and hairy legs are 100%, the proportion of beards reaches 90%, and the proportion of five toes reaches 98%.

[0055] 2. Weight

[0056] At the age of 10-16 weeks, the recessive white-feathered Beijing oil chickens were weighed every two weekends (after 12 hours of fasting), and the...

experiment example 2

[0072] Experimental Example 2 Molecular Detection of Recessive White Feather Peking Chicken

[0073] Sato et al. in 2007 confirmed that a 7.7kb insertion in the fourth intron of tyrosinase (TYR) was the direct cause of the recessive white feather trait. Referring to the report of Xu Jiguo et al. in 2011, three pairs of primers were designed:

[0074] Forward primer F1: CCTCTGGCTCTATTTGACTACACAGT,

[0075] Forward primer F2: CAAAACCATAAATAGCACTGGAAATAG,

[0076] Reverse primer R: TTGAGATACTGGAGGTCTTTAGAAATG.

[0077] The mutation can be typed by 2% agarose detection after PCR amplification. If the product has only one 481bp fragment, the individual is homozygous for colored feathers; if there is only one 345bp fragment, it is homozygous for recessive white feather; if two fragments (345bp, 481bp) appear at the same time, the individual is heterozygous for colored feathers. See image 3 :

[0078] Lanes 1-3 are recessive white feather homozygotes;

[0079] Lanes 4-6 are h...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a recessive white feather Beijing fatty chicken breeding method. The recessive white feather Beijing fatty chicken breeding method comprises the following steps: firstly, hybridizing purebred Beijing fatty female chickens with recessive white feather male chickens to obtain an F1 generation, secondly, crossing the F1 generation to obtain an F2 generation, thirdly, selecting fine quality white feather female chickens from the F2 generation to backcross the fine quality white feather female chickens with the purebred Beijing fatty male chickens to obtain an F3 generation, fourthly, crossing the F3 generation lou to obtain an F4 generation lou, fifthly, selecting a white feather crested F4 sub lou from the F4 generation lou and conducting crossing to obtain an F5 generation crested white feather Beijing fatty chicken sub lou, meanwhile, selecting a white feather bearded F'4 sub lou from the F4 generation lou and conducting crossing to obtain an F'5 generation bearded white feather Beijing fatty chicken sub lou, sixthly, conducting reciprocal hybridization on the F5 generation sub lou with the F'5 generation sub lou to obtain an F6 generation lou, seventhly, picking white feather chickens with all crested, breaded, feather-legged and five-toed features, persevering breeds of the picked chickens and conducting crossing to obtain an F7 generation, eighthly, close-breeding the F7 generation to obtain recessive white feather Beijing fatty chickens. The recessive white feather Beijing fatty chickens are high in growth speed and good in meat quality.

Description

technical field [0001] The invention belongs to the field of poultry genetics and breeding, and relates to a method for cultivating recessive white-feathered Peking chicken. Background technique [0002] With the development of social economy and the improvement of people's consumption level, consumers have higher and higher requirements for the quality of poultry products, and products with unique flavor and nutritional value such as chai chicken (native chicken) are more and more popular in the market. The Beijing Municipal Government also proposes to vigorously develop urban modern agriculture and develop and produce high-quality and characteristic agricultural products with high added value. The market demand and breeding volume of Beijing fried chicken have increased on a large scale. [0003] Purebred Beijing oil chicken is a high-quality local chicken breed originally produced in the suburbs of Beijing. It is famous for its unique appearance and high-quality meat and...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A01K67/02
CPCA01K67/02
Inventor 刘华贵初芹张剑陶士军曾另超张尧
Owner BEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More