A pcr-rflp method for rapid identification of Clover and its pseudo-mixtures

A PCR-RFLP, cloverleaf technology, applied in biochemical equipment and methods, microbial determination/inspection, etc., to achieve the effect of less primers, increased resolution, and effective identification

Active Publication Date: 2017-03-29
ZHEJIANG PHARMA COLLEGE
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there are only ITS2 gene sequences of other plants of the genus Cliflea genus, Cliffia chinensis, and Twig vine in Genbank, and there is no related gene sequence of Clover ITS2. Therefore, it is particularly necessary to establish a rapid identification method for the traditional Chinese medicine Clover in this field.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A pcr-rflp method for rapid identification of Clover and its pseudo-mixtures
  • A pcr-rflp method for rapid identification of Clover and its pseudo-mixtures
  • A pcr-rflp method for rapid identification of Clover and its pseudo-mixtures

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Example 1 Extraction of medicinal material DNA

[0043] Collect samples of Clover and various medicinal materials, and use the common CTAB (cetyltrimethylammonium bromide) method for extracting plant DNA or use the plant genome DNA extraction kit to extract sample DNA.

[0044] 1. Take about 0.5g of the sample in a mortar, add liquid nitrogen to grind it into a fine powder, and carefully transfer it to a 2ml centrifuge tube;

[0045] 2. Add 700 μL of 2% CTAB extract preheated at 65°C (CTAB 4g, NaCl 16.364g, 1M Tris-HCl 20ml (pH8.0), 0.5M EDTA 8ml, first dissolve with 70ml ddH2O, then dilute to 200ml bacteria, after cooling, add 0.2-1% β-mercaptoethanol), mix thoroughly, and keep warm in a water bath at 65°C for 40 minutes, shaking gently from time to time;

[0046] 3. Take out the centrifuge tube, centrifuge at 12000r / min for 10min, use a micropipette to suck out the supernatant, put it into a clean centrifuge tube, add an equal volume of chloroform-isoamyl alcohol (24...

Embodiment 2

[0051] Embodiment two PCR amplification of medicinal material DNA

[0052] 1. Design the primer sequence according to the internal transcribed spacer region of ribosomal DNA, the forward primer is the nucleotide sequence shown in SEQ ID NO.1: 5'ATGCGATACTTGGTGTGAAT 3'; the reverse primer is the nucleotide sequence shown in SEQ ID NO.2 Nucleotide sequence: 5'GACGCTTCTCCAGACTACAAT 3'.

[0053] 2. PCR amplification is a 25 μL reaction system, which consists of the following components:

[0054]

[0055] 3. Amplification program: pre-denaturation at 95°C for 5 minutes; then cycle, denaturation at 95°C for 30 sec, annealing at 55°C for 30 sec, extension at 72°C for 40 sec, 35 cycles; final extension at 72°C for 10 min.

[0056] 4. Quality inspection of PCR amplification products: take 5 μL of DNA sample, electrophoresis on 2% agarose gel, voltage 120V, electrophoresis time is about 30min, after electrophoresis, the gel is stained with 0.5μg / mL EB, under the ultraviolet gel imag...

Embodiment 3

[0057] Example 3 Sequence Analysis of PCR Products

[0058] The PCR product was taken for DNA sequencing, using bidirectional sequencing, and part of the sequencing peaks are shown in figure 2 , the sequence determination result is the nucleotide sequence shown in SEQID NO.3, which does not include the primer sequences at the 5' and 3' ends. The samples from Lishui, Wenling, Xiangshan in Zhejiang, Tianlin and Leye in Guangxi, Shaoyang, Yiyang, Yuanling in Hunan, Wanan and Shangrao in Jiangxi and other closely related varieties Tuqier, Aconitum, Daqingteng, The sequence of the PCR amplification products of the close relatives of A. clover and Crawling twig, after sequence analysis, the sample sequence of A. clover has the restriction endonuclease Nco I recognition sequence CCATGG, while other closely related samples are around 315bp There is no recognition site for this enzyme.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of molecular markers and discloses a PCR-RFLP method for rapidly identifying radix tetrastigme and various counterfeits and adulterants of the radix tetrastigme. The method comprises the following steps: 1, extracting the NDA of the medicinal material (namely the radix tetrastigme); 2, carrying out PCR amplification by forward and reverse primers of internal transcribed spacer ITS2 sequences of a pair of amplified ribosomal DNAs; 3, digesting the PCR product by restriction enzyme NCO I; 4, carrying out agarose gel electrophoresis analysis. After the enzyme digestion of amplified products of the DNA of the radix tetrastigme, two DNA fragments with sizes about 335 bp and 200 bp are generated, and the various counterfeits and adulterants are not identified by the NCO I enzyme. By utilizing the differences between the DNA sequences of radix tetrastigme and the counterfeits and adulterants of the radix tetrastigme, a quick, convenient and reliable PCR-RFLP identification method is established and used for identifying whether counterfeits and adulterants are mixed in the radix tetrastigme or not, so that the technical problem that the truth and false cannot be identified by sensory or physical and chemical analysis methods is solved, and the medication safety of the radix tetrastigme is ensured.

Description

technical field [0001] The invention belongs to the technical field of molecular markers, and in particular relates to a PCR-RFLP method for quickly identifying trilobites and various pseudo-mixtures thereof. Background technique [0002] Clover (Tetrastigma hemsleyanum), also known as golden thread hanging gourd, is a perennial herbaceous plant of the genus Cliffaceae, whose underground tuber root is the main medicinal part, and can be used to treat high fever, hepatitis, rheumatoid arthritis and viral meningitis It is also a commonly used anti-tumor drug for many diseases. At present, the wild resources of this plant are on the verge of extinction, and its requirements on the growth environment are very harsh, artificial cultivation is difficult, and its development and utilization are greatly restricted. Due to the scarcity of resources and the high demand, the price of clover has been rising continuously. Various pseudo-mixed products such as tukeer, daqingteng, aconitu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/68
CPCC12Q1/683C12Q1/686C12Q2531/113C12Q2563/185C12Q2521/301C12Q2565/125C12Q2537/143
Inventor彭昕吉庆勇张煜炯范三微何军邀
OwnerZHEJIANG PHARMA COLLEGE