Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

ADC-drug-modified antibody IgG1-CH-K330C for establishing radioactive isotope coupling labelling

A technology of igg1-ch-k330c, radioisotope, applied in the field of biomedicine to achieve the effect of maintaining selectivity and stability

Inactive Publication Date: 2015-05-27
RENOPHARMA INC
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] At present, there is a lack of a mutation point that does not affect the targeting and functionality of the antibody. The mutation point does not affect the activity of the antibody variable region binding to the antigen; maintains the conformation and function of the crystallizable fragment region; the point mutation is located in the antibody molecule Surface; mutate antibodies that attach linkers under mild conditions

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • ADC-drug-modified antibody IgG1-CH-K330C for establishing radioactive isotope coupling labelling
  • ADC-drug-modified antibody IgG1-CH-K330C for establishing radioactive isotope coupling labelling
  • ADC-drug-modified antibody IgG1-CH-K330C for establishing radioactive isotope coupling labelling

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] Design of IgG1 mutation sites

[0047] In order to obtain the humanized structure of the anti-HER2 antibody, we loaded the antibody protein sequence (the amino acid sequence is listed below) into the homology modeling software of Molecular Operations Platform (MOE). The crystal structure of 1HZH was selected in the protein structure database as the modeling template of the anti-HER2 antibody. The anti-HER2 antibody initial geometric sequence part is copied from one or more 1HZH chain region templates. In the part of residues conserved in anti-HER2 antibody and 1HZH sequence, all heavy atoms were copied to anti-HER2 antibody, otherwise only the backbone part was copied. When the cysteines in the template chain that can form disulfide bonds correspond to the positions of the cysteines in the anti-HER2 antibody sequence, the disulfide bonds are copied into the model. After determining the intermediate model of the backbone segment and side chain conformation, hydrogenati...

Embodiment 2

[0056] Taking the anti-HER2 monoclonal antibody Herceptin as an example, the CH3 amino acid site of the heavy chain constant region of the antibody was mutated

[0057] (1) Synthesis of light and heavy chain variable regions of Herceptin monoclonal antibody

[0058] The DNA of the light chain variable region and the heavy chain variable region of the Herceptin monoclonal antibody were synthesized by using the DNA sequences of the light chain variable region and the heavy chain variable region of the Herceptin monoclonal antibody as templates, respectively, by PCR method.

[0059] Primers for synthesizing light and heavy chain variable regions:

[0060] Herceptin heavy chain upstream primer:accagggtgctgagcgaggtgcagctggtggagagcgg

[0061] Herceptin heavy chain downstream primer: gcccttggtgctagcgctgctcacggtcaccagggtg

[0062] Herceptin light chain upstream primer: ataatgagtagggggagacatccagatgacccagag

[0063] Herceptin light chain downstream primer: gtgcagccaccgtacgcttgatctcca...

Embodiment 3

[0092] Transfection and antibody expression and purification

[0093] Purify Herceptin variable region light and heavy chain plasmids and mutated heavy chain constant region plasmids by column method. The synthesized and purified Herceptin variable region light and heavy chain plasmids and the mutated heavy chain constant region plasmids and light chain constant region plasmids were transfected into mammalian cells for expression.

[0094] Insert 3L of 0.5×10 6 cells / mL of HEK293 cells, cultured at 37°C at 150 rpm until the concentration of viable cells reached 1.5-2.0×10 6 cells / mL, add 4.5L serum-free chemically defined medium to dilute the cell culture medium.

[0095] every 10 6 Add 2ul Freestyle Max transfection reagent (Invitrogen) to the cells, every 10 6 1ug of DNA was added to the cells. The transfection mixture was prepared according to the instructions of Invitrogen. Add Feed X (ACRO) to the culture medium at a ratio of 5:100 24 hours after transfection, and a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an ADC-drug-modified antibody IgG1-CH-K330C for establishing radioactive isotope coupling labelling, which comprises (a) an amino acid sequence of a heavy chain constant region, an amino acid sequence of a heavy chain constant region CH2 and an amino acid sequence of a heavy chain constant region CH3 obtained by mutation modification; (b) an amino acid sequence of the heavy chain variable region disclosed as SEQ ID NO:2; (c) an amino acid sequence of the light chain variable region disclosed as SEQ ID NO:4; and (d) an amino acid sequence of the light chain constant region disclosed as SEQ ID NO:6. On the premise of not influencing the targeting properties and functions of the antibody, the antibody surface is subjected to site-directed mutagenesis, thereby controlling the number of the connected active micromolecules, and carrying a stable number of micromolecules, toxins or nuclides.

Description

technical field [0001] The invention relates to the field of biomedicine, in particular to a modified antibody IgG1-CH-K330C used for constructing radioactive isotope coupling-labeled ADC drugs. Background technique [0002] Modern biology has proved that cancer has a strong diversity, and drugs with poor selectivity will have a great negative effect on normal cells. At present, the research and development of new cancer drugs is slow, and there are still a large number of cancers without better treatments. The five-year survival rates of liver cancer, lung cancer, and pancreatic cancer are all below 15%. The current platforms for the development of new cancer drugs are roughly divided into monoclonal antibody macromolecular biological drugs and small molecule chemical drugs. Small molecule chemical drugs have poor selectivity and can cause unpredictable toxicity to normal cells. Monoclonal antibody, referred to as monoclonal antibody, has high selectivity for a certain ty...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K16/32C07K16/28C12N15/13A61K51/10A61K47/48A61P35/00A61P37/02A61K47/68
Inventor 梅岩李涛
Owner RENOPHARMA INC
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com