Check patentability & draft patents in minutes with Patsnap Eureka AI!

Engineered antibody IgG1-CH-N267C of ADC (antibody-drug conjugate) for building radioactive isotope conjugation label

A technology of igg1-ch-n267c, radioisotope, applied in the field of biomedicine to achieve the effect of maintaining selectivity and stability

Inactive Publication Date: 2015-06-03
RENOPHARMA INC
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] At present, there is a lack of a mutation point that does not affect the targeting and functionality of the antibody. The mutation point does not affect the activity of the antibody variable region binding to the antigen; maintains the conformation and function of the crystallizable fragment region; the point mutation is located in the antibody molecule Surface; mutate antibodies that attach linkers under mild conditions

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Engineered antibody IgG1-CH-N267C of ADC (antibody-drug conjugate) for building radioactive isotope conjugation label
  • Engineered antibody IgG1-CH-N267C of ADC (antibody-drug conjugate) for building radioactive isotope conjugation label
  • Engineered antibody IgG1-CH-N267C of ADC (antibody-drug conjugate) for building radioactive isotope conjugation label

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 2

[0054] Taking the anti-HER2 monoclonal antibody Herceptin as an example, the CH3 amino acid site of the heavy chain constant region of the antibody was mutated

[0055] (1) Synthesis of light and heavy chain variable regions of Herceptin monoclonal antibody

[0056] The light chain variable region DNA and the heavy chain variable region DNA of the Herceptin monoclonal antibody were synthesized using the PCR method, respectively, using the DNA sequences of the light chain variable region and the heavy chain variable region of the Herceptin monoclonal antibody as templates.

[0057] Primers for synthesizing light and heavy chain variable regions:

[0058] Herceptin heavy chain upstream primer:accagggtgctgagcgaggtgcagctggtggagagcgg

[0059] Herceptin heavy chain downstream primer: gcccttggtgctagcgctgctcacggtcaccagggtg

[0060] Herceptin light chain upstream primer: ataatgagtagggggagacatccagatgacccagag

[0061] Herceptin light chain downstream primer: gtgcagccaccgtacgcttgatctcc...

Embodiment 3

[0092] Transfection and antibody expression and purification

[0093] Purify Herceptin variable region light and heavy chain plasmids and mutated heavy chain constant region plasmids by column method. The synthesized and purified Herceptin variable region light and heavy chain plasmids and the mutated heavy chain constant region plasmids and light chain constant region plasmids were transfected into mammalian cells for expression.

[0094] Insert 3L of 0.5×10 6 cells / mL of HEK293 cells, cultured at 37°C at 150 rpm until the concentration of viable cells reached 1.5-2.0×10 6 cells / mL, add 4.5L serum-free chemically defined medium to dilute the cell culture medium.

[0095] every 10 6 Add 2ul Freestyle Max transfection reagent (Invitrogen) to the cells, every 10 6 1ug of DNA was added to the cells. The transfection mixture was prepared according to the instructions of Invitrogen. Add Feed X (ACRO) to the culture medium at a ratio of 5:100 24 hours after transfection, and a...

Embodiment 4

[0098] The effect of antibody binding to antigen HER2 before and after mutation was detected in vitro by ELISA method

[0099] To determine the specificity of binding of the mutated antibodies to HER2, an ELISA was performed against HER2 and a control protein. Dilute HER2 protein to 1-10 μg / ml with coating buffer, add 100 ul to each well, and coat at 4°C overnight. Wash 3 times the next day. Add a certain diluted Herceptin sample and 0.1ml of mutant antibody to the corresponding coated reaction wells, incubate at 37°C for 1 hour, and wash. (Consider the blank, negative and positive wells at the same time) Add 0.1ml of freshly diluted enzyme-labeled secondary antibody (anti-antibody) to the reaction well, incubate at 37°C for 30-60 minutes, wash, and wash with DDW for the last time. Adding substrate solution for color development: add 0.1ml of temporarily prepared TMB substrate solution to each reaction well, and keep at 37°C for 10-30 minutes. Termination of the reaction: A...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an engineered antibody IgG1-CH-N267C of ADC (antibody-drug conjugate) for building a radioactive isotope conjugation label. The engineered antibody IgG1-CH-N267C comprises (a), heavy chain constant regions which comprise an amino acid sequence in a heavy chain constant region CH1, an amino acid sequence in a heavy chain constant region CH2, and an amino acid sequence obtained after mutation modification in a heavy chain constant region CH3; (b) a heavy chain variable region, wherein an amino acid sequence of the heavy chain variable region is shown in SEQ ID No:2; (c), a light chain variable region, wherein an amino acid sequence of the light chain variable region is shown in SEQ ID No:4; (4), a light chain constant region, wherein an amino acid sequence in the light chain constant region is shown in SEQ ID No:6. On the premise that the targeting performance and the functionality of an antibody are not influenced, site-specific mutagenesis is performed on the antibody surface, the number of small activated molecules to be connected can be controlled, and a steady quantity of small modules, toxin or nuclide can be carried.

Description

technical field [0001] The invention relates to the field of biomedicine, in particular to a modified antibody IgG1-CH-N267C used for constructing radioactive isotope coupling-labeled ADC drugs. Background technique [0002] Modern biology has proved that cancer has a strong diversity, and drugs with poor selectivity will have a great negative effect on normal cells. At present, the research and development of new cancer drugs is slow, and there are still a large number of cancers without better treatments. The five-year survival rates of liver cancer, lung cancer, and pancreatic cancer are all below 15%. The current platforms for the development of new cancer drugs are roughly divided into monoclonal antibody macromolecular biological drugs and small molecule chemical drugs. Small molecule chemical drugs have poor selectivity and can cause unpredictable toxicity to normal cells. Monoclonal antibody, referred to as monoclonal antibody, has high selectivity for a certain ty...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K16/32C07K16/28C12N15/13A61K51/10A61K47/48A61P35/00A61P37/02A61K47/68
Inventor 梅岩李涛
Owner RENOPHARMA INC
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com