Panax notoginseng molecule ID and identification method
A technology of molecular ID card and identification method, which is applied in the field of identification of source varieties of Chinese medicinal materials, can solve the problems of identification barriers, high subjectivity, and difficulty in accurate identification, and achieve the effect of accurate identification and wide applicability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1 10
[0031] The identification method of embodiment 1 Panax notoginseng medical material raw material
[0032] 1) Forty-five samples of Panax notoginseng collected from different medicinal material stores and places of production (Yunnan), 20 mg of medicinal materials were taken respectively, and ground on a MM400 ball mill (Retsch, Germany), and plant genomic DNA from Tiangen Biochemical Technology (Beijing) Co., Ltd. The kit extracts total DNA.
[0033] 2) PCR amplification
[0034] The primer sequence is ITS2F: ATGCGATACTTGGTGTGAAT; ITS3R: GACGCTTCTCCAGACTACAAT, synthesized by Sangon Bioengineering Co., Ltd. (Beijing). Primers were dissolved in sterile deionized and diluted to 2 μmol / μL.
[0035] 25μL reaction system: PCR Buffer (10×) 2.5μL, Mg 2+ 2 μL (25 mmol / L), 2 μL (2.5 mmol / L) of dNTPs mixture, 1.0 μL (2.5 μmol / L) of each primer, 1 μL (~30ng) of template DNA, 1.0 U of Taq DNA polymerase, add sterilized double distilled water to 25 μL for PCR amplification.
[0036] PC...
Embodiment 2 10
[0044] The identification of embodiment 2 Panax notoginseng
[0045] Adopt the method identical with embodiment 1 to carry out identification, difference is that notoginseng flower is sample, extract DNA, carry out identification, the result shows, can specifically detect the sequence shown in SEQ IDNo.1 and SEQ ID No. 2 shows the sequence.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 