Unlock instant, AI-driven research and patent intelligence for your innovation.

Panax notoginseng molecule ID and identification method

A technology of molecular ID card and identification method, which is applied in the field of identification of source varieties of Chinese medicinal materials, can solve the problems of identification barriers, high subjectivity, and difficulty in accurate identification, and achieve the effect of accurate identification and wide applicability

Inactive Publication Date: 2015-08-12
INST OF MEDICINAL PLANT DEV CHINESE ACADEMY OF MEDICAL SCI
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the high price of Panax notoginseng medicinal materials, counterfeit products often appear in the market
Panax notoginseng, Panax notoginseng, Panax notoginseng and its variants Panax notoginseng, Pearl ginseng and Gedaqi, ginger-shaped Panax notoginseng, Pingbian Panax notoginseng and pseudo-ginseng are all used as medicines. Similarly, the traditional character identification has certain difficulties in the identification of Panax notoginseng and its related species, especially for the identification of Panax notoginseng flowers and powder in the medicinal material market.
[0003] The existing traditional identification methods for Panax notoginseng are extremely difficult to accurately identify in practical applications, and have the disadvantages of high subjectivity, poor versatility, and high requirements for observer experience
Molecular identification methods are more accurate and reliable, but there is no unified standardized method at present.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Panax notoginseng molecule ID and identification method
  • Panax notoginseng molecule ID and identification method
  • Panax notoginseng molecule ID and identification method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1 10

[0031] The identification method of embodiment 1 Panax notoginseng medical material raw material

[0032] 1) Forty-five samples of Panax notoginseng collected from different medicinal material stores and places of production (Yunnan), 20 mg of medicinal materials were taken respectively, and ground on a MM400 ball mill (Retsch, Germany), and plant genomic DNA from Tiangen Biochemical Technology (Beijing) Co., Ltd. The kit extracts total DNA.

[0033] 2) PCR amplification

[0034] The primer sequence is ITS2F: ATGCGATACTTGGTGTGAAT; ITS3R: GACGCTTCTCCAGACTACAAT, synthesized by Sangon Bioengineering Co., Ltd. (Beijing). Primers were dissolved in sterile deionized and diluted to 2 μmol / μL.

[0035] 25μL reaction system: PCR Buffer (10×) 2.5μL, Mg 2+ 2 μL (25 mmol / L), 2 μL (2.5 mmol / L) of dNTPs mixture, 1.0 μL (2.5 μmol / L) of each primer, 1 μL (~30ng) of template DNA, 1.0 U of Taq DNA polymerase, add sterilized double distilled water to 25 μL for PCR amplification.

[0036] PC...

Embodiment 2 10

[0044] The identification of embodiment 2 Panax notoginseng

[0045] Adopt the method identical with embodiment 1 to carry out identification, difference is that notoginseng flower is sample, extract DNA, carry out identification, the result shows, can specifically detect the sequence shown in SEQ IDNo.1 and SEQ ID No. 2 shows the sequence.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a panax notoginseng molecule ID which contains a nucleotide sequence represented as the SEQ ID No.1 and / or the SEQ ID No.2. The panax notoginseng molecule ID and an identification method therewith can accurately separate panax notoginseng from a fake product thereof, which is similar with true panax notoginseng in appearance. The method is wider in adaptability, can be used for detecting any samples of which DNA can be extracted, so that the panax notoginseng molecule ID can achieve quick and accurate identification of raw plants, medicines, seeds, seedlings, powders and adulterants of the panax notoginseng.

Description

technical field [0001] The invention belongs to the technical field of identification of source varieties of Chinese medicinal materials, and in particular relates to a molecular ID card of Panax notoginseng and an identification method. Background technique [0002] Panax notoginseng (Panax notoginseng) is a perennial plant of the genus Ginseng. It is a traditional precious Chinese medicinal material in my country. It has been used for more than 400 years and has a long-standing reputation at home and abroad. Sanqi has been known as the "hemostatic medicine" since ancient times. It has the effects of dissipating blood stasis and hemostasis, reducing swelling and relieving pain. Indications for hemoptysis, hematemesis, epistaxis, hematochezia, metrorrhagia, traumatic bleeding, chest and abdomen tingling, tumbling pain. Due to the unique hemostatic effect of Panax notoginseng, there is a huge demand for it. Enterprises such as Yunnan Baiyao Group, Tianjin Tasly, and Guangzho...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
Inventor 陈士林韩建萍王晓玥宋经元
Owner INST OF MEDICINAL PLANT DEV CHINESE ACADEMY OF MEDICAL SCI