Protein transduction domain derived from fish nervous necrosis virus as well as preparation method and use of protein transduction domain
A technology of protein transduction domain and neural necrosis, which is applied in the preparation of the protein transduction domain, and the field of protein transduction domain derived from fish neuronecrosis virus, which can solve the problem of unsatisfactory drug effect and difficult access of therapeutic molecules and drugs Intracellular site of action, difficult to achieve effective concentration, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0040] The technical solutions of the present invention will be described in further detail below in conjunction with the accompanying drawings and specific embodiments, but the protection scope of the present invention is not limited to the following embodiments.
[0041] The open reading frame (ORF) of the capsid protein (CP) gene of orange-spotted grouper nervous necrosis virus (OGNNV) is 1017 nucleotide bases, and the code contains 338 amino acids of the capsid protein. 3-16 was constructed on the prokaryotic expression vector of pRSET-A containing GFP, and by analyzing the multiple cloning site of pRSET-A and the capsid protein MCP gene of the oblique grouper neuronecrosis virus, EcoR was selected as the restriction site I and Hind III serve as restriction restriction sites.
[0042] 1.1 Design of primers
[0043] The following primers were designed and synthesized:
[0044] F: AATTCCGCAAAGGTGAGAAGAAATTGGCAAAACCCGCGACCACCAAGTAACGA (EcoR I)
[0045] R: AGCTTCGTTACTTGGT...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com