Check patentability & draft patents in minutes with Patsnap Eureka AI!

Protein transduction domain derived from fish nervous necrosis virus as well as preparation method and use of protein transduction domain

A technology of protein transduction domain and neural necrosis, which is applied in the preparation of the protein transduction domain, and the field of protein transduction domain derived from fish neuronecrosis virus, which can solve the problem of unsatisfactory drug effect and difficult access of therapeutic molecules and drugs Intracellular site of action, difficult to achieve effective concentration, etc.

Active Publication Date: 2015-09-02
SUN YAT SEN UNIV
View PDF2 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

During the breeding process, especially in the juvenile fish stage, the acquired immune system of the fish itself has not yet fully developed. Resulting in close to 100% mortality, causing significant economic losses to farmers
At present, although a variety of drugs for defense and treatment of NNV have been developed, it takes a long time for the drugs to reach the target site, especially the existence of selectively permeable cell membranes, making it difficult for therapeutic molecules and drugs to reach the cells internal action site
Therefore, even if the drug enters the body, the effect of the drug may be unsatisfactory due to the non-specificity of the site of action and the difficulty in reaching an effective concentration.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Protein transduction domain derived from fish nervous necrosis virus as well as preparation method and use of protein transduction domain
  • Protein transduction domain derived from fish nervous necrosis virus as well as preparation method and use of protein transduction domain
  • Protein transduction domain derived from fish nervous necrosis virus as well as preparation method and use of protein transduction domain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0040] The technical solutions of the present invention will be described in further detail below in conjunction with the accompanying drawings and specific embodiments, but the protection scope of the present invention is not limited to the following embodiments.

[0041] The open reading frame (ORF) of the capsid protein (CP) gene of orange-spotted grouper nervous necrosis virus (OGNNV) is 1017 nucleotide bases, and the code contains 338 amino acids of the capsid protein. 3-16 was constructed on the prokaryotic expression vector of pRSET-A containing GFP, and by analyzing the multiple cloning site of pRSET-A and the capsid protein MCP gene of the oblique grouper neuronecrosis virus, EcoR was selected as the restriction site I and Hind III serve as restriction restriction sites.

[0042] 1.1 Design of primers

[0043] The following primers were designed and synthesized:

[0044] F: AATTCCGCAAAGGTGAGAAGAAATTGGCAAAACCCGCGACCACCAAGTAACGA (EcoR I)

[0045] R: AGCTTCGTTACTTGGT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a protein transduction domain derived from fish nervous necrosis virus. An amino acid sequence of the protein transduction domain is as shown in SEQ ID: 1. The protein transduction domain also provides a preparation method of the protein transduction domain, as well as use and application of the protein transduction domain to carrying allogenic materials to enter cells as well as preparing medicaments for controlling fish diseases. Compared with the prior art, the protein transduction domain provided by the invention has higher efficiency of entering fish cells.

Description

technical field [0001] The invention belongs to the field of bioengineering, and in particular relates to a protein transduction domain derived from fish (especially grouper) neuronecrosis virus, as well as a preparation method and application of the protein transduction domain. Background technique [0002] Grouper is a rare and valuable seawater economic fish. During the breeding process, especially in the juvenile fish stage, the acquired immune system of the fish itself has not yet fully developed. Cause close to 100% mortality rate, cause great economic loss to the raiser. At present, although a variety of drugs for defense and treatment of NNV have been developed, it takes a long time for the drugs to reach the target site, especially the existence of selectively permeable cell membranes, making it difficult for therapeutic molecules and drugs to reach the cells internal action site. Therefore, even if the drug enters the body, the effect of the drug may be unsatisf...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K7/08C12N15/40C12N15/70A61K47/42A61P31/00
Inventor 谢俊锋杨少伟何建国
Owner SUN YAT SEN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More