Check patentability & draft patents in minutes with Patsnap Eureka AI!

Overexpression porcine co-stimulatory 4-1BB vector and application thereof

A carrier and expression cassette technology, which is applied in the field of preparation of 4-1BB transgenic pigs, can solve the problems of loss of function, gene frameshift mutation, etc., and achieve the effects of enhanced effect function, low cost and shortened time

Inactive Publication Date: 2015-11-25
CHINA AGRI UNIV
View PDF6 Cites 54 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The CRISPR / Cas system generates a double strand DNA break (doublestrandbreak, DSB) at the target site, and the cell can be repaired by non-homologous end joining (NHEJ), resulting in a frameshift mutation of the gene and loss of function

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Overexpression porcine co-stimulatory 4-1BB vector and application thereof
  • Overexpression porcine co-stimulatory 4-1BB vector and application thereof
  • Overexpression porcine co-stimulatory 4-1BB vector and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 14-1BB

[0044] Construction of embodiment 14-1BB homologous recombination vector

[0045] The step of constructing the 4-1BB homologous recombination vector includes using the target biological genome as a template, PCR amplifying the left and right homology arms, the 4-1BB regulatory sequence, and the embryonic period specific regulatory element OCT4. The homologous left arm, 4-1BB expression frame, Cre containing LoxP site, Neo expression frame, homologous right arm, and negative selection DTA were sequentially connected to form the 4-1BB homologous recombination vector p4BOCNDR. The specific construction process is as follows:

[0046] The Yorkshire pig ear tissue with excellent production performance was taken, and a porcine fibroblast cell line was established by tissue block inoculation method, named YKX001, and conventional cell passage and cryopreservation. For detailed methods of cell culture, subculture and cryopreservation, please refer to "Refined Cell Biology Experiment ...

Embodiment 2

[0055] Example 2 Construction of CRISPR / Cas9 Targeting Vector

[0056] According to the CRISPR target sequence design website (http: / / crispr.genome-engineering.org / ), the target site of the first intron of porcine rosa26 site was predicted and analyzed. Select a sequence with the highest score from the candidate target sites and name it target1. Its sequence and reverse complementary sequence are TCCAGTCCCAGACATAGCAT (SEQ ID NO. 21) and ATGCTATGTCTGGGACTGGA (SEQ ID NO. 22) respectively, and complementary paired oligonucleotides are synthesized respectively. As shown in Table 1, the underlines are restriction sites.

[0057] Table 1 Oligonucleotide sequence

[0058]

[0059] Dilute the synthesized pair of oligonucleotide sequences to 100 μM, take 1 μL of 10 μL reaction system, add 10×PCR buffer, mix well, anneal, 94°C, 5min; 37°C, 10min; 4°C, 5min. The obtained annealed product can be connected with the backbone of pX330 digested with BbsI. For routine transformation met...

Embodiment 34-1B

[0063] Example 34- Preparation and identification of 1BB transgenic cell line

[0064] The Yorkshire pig skin fibroblast cell line with male sex and 50-day gestational age was selected, and the cell recovery, culture and subculture were referred to "Guidelines for Cell Biology Experiments" (J.S. Boniface et al., translated by Zhang Jingbo, et al. 2007, Science Press). When the cells grow confluent to about 80%, digest and collect the cells (about 1×10 6 ), add 2 μg of each of the vectors constructed in Examples 1 and 2 and 100 μL of Nucleofector reagent, mix well, add to the electric shock cup, and perform electric shock transfection with the A-024 program. Then inoculated into 10cm Petri dish at 1:20, 37.5°C, 5% CO 2cultured in an incubator. After 24 hours, the complete medium (10% FBS+DMEM) containing 500 μg / mL G418 was replaced, and the medium was changed every 3 to 4 days, and the concentration of G418 increased to 800 μg / mL after 96 hours. The formation of colony spot...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an overexpression porcine co-stimulatory 4-1BB vector and application thereof. PCR (polymerase chain reaction) amplification is performed on a left homologous arm and a right homologous arm of an intron 1 of a rosa26 gene, a 4-1BB regulatory sequence and an OCT4 specific promoter; the left homologous arm, a 4-1BB expression cassette, LoxP locus-contained Cre and Neo expression cassettes, the right homologous arm and negative selection DTA diphtheria toxin are connected in sequence to obtain a 4-1BB homologous recombinant vector p4BOCNDR; the vector and a CRISPR / Cas9 (clustered regularly interspaced short palindromic repeats / CRISPR-associated) targeting vector of sgRNA (small guide ribonucleic acid) containing the intron 1 of the specific targeting porcine rosa26 gene are transferred together into a porcine fetus fibroblast; by taking a positive cell as a donor cell and an oocyte as a recipient cell, a cloned embryo is obtained through a somatic cell nuclear transfer technique; the cloned embryo is transplanted into a porcine uterus for fetation to obtain a transgenic pig integrating a 4-1BB gene at the fixed point of a first intron of the rosa26 gene and automatically deleting a marker gene.

Description

technical field [0001] The invention belongs to the field of animal genetic engineering and genetic modification, and in particular relates to a 4-1BB gene modification method using a CRISPR / Cas9 system and a preparation method for a 4-1BB transgenic pig. Background technique [0002] Mammals and other vertebrates have gradually formed a strong immune protection barrier in the process of responding to the invasion of various pathogenic microorganisms from the outside world and eliminating foreign substances to maintain their own balance. Includes humoral and cellular immunity. T cells are at the heart of most immune responses. After recognizing a specific antigen, T cells are activated, proliferated, and differentiated to have effector or auxiliary functions. initial Activation of T cells requires two stimulatory signals from antigen presenting cells. The first is the specific antigen stimulation signal generated by the combination of TCR / CD3 and the specific MHC-antige...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/66C12N15/85A01K67/027
Inventor 李秋艳索勋黄广平李志远李向清刘贤勇付怡静王一丁田秀玲索静霞胡丹丹
Owner CHINA AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More