Dual PCR method for detecting theileria hirci and anaplasma
A Theileria sheep, no plasma technology, applied in the field of molecular biology, can solve the problems of cumbersome operation and low detection rate, and achieve the effects of simple operation, high specificity and simple result judgment
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0044] One, a kind of double PCR method that detects Theileria sheep and anplasma, comprises the following steps:
[0045] (1) Primer design
[0046] According to GenBank accession numbers: AF081136.1, KJ188221.1, AY260172.1, AF081137.1, U97052.1, DNAMAN version 6.0.3.99 software was used to compare the 18S rRNA gene sequence of Theileria ovis to find the target gene site of the gene conservative sequence, The specific primer sequence I was designed as: the upstream primer Tf: 5'ATTCCCGCATCCTATTTAGCAG3', the position in the U97052.1 genome is 1009~1026 and the downstream primer Tr: 5'CGACTCCTTCAGCACCTT3', the position in the U97052.1 genome is the 1st 1285~1306 bits;
[0047] According to the GenBank accession numbers: JQ917906.1, AY149637.1, JF514513.1, AF311303.1, using DNAMAN version 6.0.3.99 software to compare the 16S rRNA gene sequence of sheep anplasma, find the conserved sequence of the gene as the target locus, and design Specific primer sequence II: Upstream prim...
Embodiment 2
[0084] Preliminary Application of Double PCR Method for Theileria sheep and Anaplasma
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap