Unlock instant, AI-driven research and patent intelligence for your innovation.

Dual PCR method for detecting theileria hirci and anaplasma

A Theileria sheep, no plasma technology, applied in the field of molecular biology, can solve the problems of cumbersome operation and low detection rate, and achieve the effects of simple operation, high specificity and simple result judgment

Inactive Publication Date: 2015-12-16
HENAN AGRICULTURAL UNIVERSITY
View PDF7 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Aiming at the problems of low detection rate and cumbersome operation of the current detection methods for Theileria ovis and Aplasma, the present invention establishes a method that can simultaneously Rapid test for detection of Theileria sheep ( Theileria spp) and slurry-free ( Anaplasma spp) double PCR method

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Dual PCR method for detecting theileria hirci and anaplasma
  • Dual PCR method for detecting theileria hirci and anaplasma
  • Dual PCR method for detecting theileria hirci and anaplasma

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] One, a kind of double PCR method that detects Theileria sheep and anplasma, comprises the following steps:

[0045] (1) Primer design

[0046] According to GenBank accession numbers: AF081136.1, KJ188221.1, AY260172.1, AF081137.1, U97052.1, DNAMAN version 6.0.3.99 software was used to compare the 18S rRNA gene sequence of Theileria ovis to find the target gene site of the gene conservative sequence, The specific primer sequence I was designed as: the upstream primer Tf: 5'ATTCCCGCATCCTATTTAGCAG3', the position in the U97052.1 genome is 1009~1026 and the downstream primer Tr: 5'CGACTCCTTCAGCACCTT3', the position in the U97052.1 genome is the 1st 1285~1306 bits;

[0047] According to the GenBank accession numbers: JQ917906.1, AY149637.1, JF514513.1, AF311303.1, using DNAMAN version 6.0.3.99 software to compare the 16S rRNA gene sequence of sheep anplasma, find the conserved sequence of the gene as the target locus, and design Specific primer sequence II: Upstream prim...

Embodiment 2

[0084] Preliminary Application of Double PCR Method for Theileria sheep and Anaplasma

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a dual PCR method for detecting theileria hirci and anaplasma. The method includes the steps of finding a gene conserved seuqnece target gene locus and designing a specific primer sequence I according to the 18S rRNA gene sequence of theileria hirci, finding a gene conserved seuqnece target gene locus and designing the specific primer sequence II according to the 16S rRNA gene sequence of anaplasma, adding the upstream primer and the downstream primer of the specific primer sequence I and the upstream primer and the downstream primer of the specific primer sequence II and PCR mixed liquid into a PCR pipe, mixing the materials and adding theileria hirci DNA and anaplasma DNA extracted from a to-be-tested blood sample to the mixture, putting the PCR pipe into a PCR amplification instrument to be circulated, obtaining a PCR product, and putting the PCR product on 2% sepharose gel to be subjected to electrophoresis. The method has the advantages of being rapid, specific, sensitive, efficient, low in cost and the like and is beneficial to clinical application.

Description

technical field [0001] The invention belongs to the field of molecular biology, in particular to a method for detecting Theileria sheep ( Theileria spp) and slurry-free ( Anaplasma spp) double PCR method. technical background [0002] Theileriasis of sheep is a tick-borne blood protozoan disease of sheep and goats caused by the pathogen of the genus Theileria ovis. The disease was first discovered in sheep in Egypt by Jittlewood in 1914, and was first reported in China by Yang Fuguo et al. In some areas, the infection rate of sheep Theileria is as high as 95%. The diseased sheep show symptoms such as high fever, enlarged lymph nodes on the body surface, anemia and emaciation, and even death in severe cases, which has caused great harm to the sheep breeding industry in my country. Sheep anplasmosis (commonly known as anaplasmosis) is a tick-borne hematological rickettsial disease caused by a pathogen of the genus Anaplasma. When sheep and goats are infected, the main mani...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/04
CPCC12Q1/686C12Q1/6893C12Q2600/16C12Q2537/143C12Q2565/125
Inventor 宁长申崔艳艳张艳菅复春张龙现王荣军曹树轩王晓星闫亚群
Owner HENAN AGRICULTURAL UNIVERSITY