Check patentability & draft patents in minutes with Patsnap Eureka AI!

Kit and method for typing HLA gene

A genotyping and kit technology, applied in biochemical equipment and methods, recombinant DNA technology, microbial measurement/inspection, etc., can solve the problems of affecting typing results, low resolution of typing results, high cost, etc., to achieve Increased typing resolution and accuracy, simple typing process, and high resolution effects

Active Publication Date: 2016-01-20
SUN YAT SEN UNIV CANCER CENT
View PDF8 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The shortcoming of above-mentioned technique has the following points (taking HLA-B genotyping as example): 1, PCR specific primer aspect: existing primer design is more numerous and diverse, needs many pairs of primers to amplify a single exon, and the cost is high , increasing the complexity of the experiment
2. In terms of typing accuracy: only rely on exon 2 and exon 3 sequence information for typing, and the resolution of typing results is low
3. Data analysis: The technical parameters of the company's typing software are kept secret, and the strategies it adopts cannot be evaluated and optimized
[0004] Reasons for the above shortcomings: 1. Design multiple pairs of primers to amplify the target fragment by PCR, because the designer did not make full use of the information in the snp database on the 1000genome and UCSC website to design primers for unbiased amplification
2. Only relying on exon 2 and exon 3 sequence information for typing is because the designer did not consider carefully and ignored that other exons of the HLA-B gene will also affect the typing results
3. The technical parameters of data analysis are kept confidential because the company needs to use the software for profit-making operations. We cannot obtain technical parameters, so we have no way to evaluate them.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit and method for typing HLA gene
  • Kit and method for typing HLA gene
  • Kit and method for typing HLA gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] This embodiment takes HLA-B genotyping as an example to perform HLA genotyping.

[0029] 1. Sample DNA preparation:

[0030] 2ml of whole blood was extracted, and DNA was extracted with the kit QIAampDNA Mini Kit Cat. No. 51304, A260 / 280=1.7-2.0.

[0031] 2. Amplify exons 2, 3, and 4 of HLA-B:

[0032] 1. Primer sequences for amplifying exons 2 and 3:

[0033] F1: CGGGAGGGAAATGGCCTCTG (SEQ ID NO.1)

[0034] R1:TTCAACGGAGGGCGACATTCTA (SEQ ID NO.2)

[0035] 2. Primer sequence for amplifying exon 4:

[0036] F2: TGTCCTGTCCATTCTCAGGC (SEQ ID NO.3)

[0037] R2: TTCCCTGAGAAGAGATATGACCC (SEQ ID NO.4)

[0038] 3. PCR reaction system and conditions:

[0039] (1) Reaction system: use high-fidelity DNA polymerase GXLDNA Polymerase Cat.No.R050A; Table 1 below:

[0040] Table 1 reaction system

[0041] Reagent

Usage amount

Final concentration

5xPrimeSTAR GXL Buffer

4μL

1x

dNTP Mixture (2.5mM)

1.6μL

200μM

forward prim...

Embodiment 2

[0100] In this example, 16 samples were traditionally typed for HLA-B by the method described in Example 1, and the typing results were completely consistent with the typing results of Boao Company.

[0101] Take HLA-B genotyping for sample No. 24 as an example:

[0102] 1. Preparation of sample DNA: the concentration of extracted DNA is 45ng / μL, about 50μL, 260 / 280=1.88

[0103] 2. Amplify exons 2, 3, and 4 of HLA-B: After PCR according to the above conditions, the electrophoresis is as follows figure 2 As shown, the figure lists the electrophoresis results of the PCR products of the four samples No. 24, 25, 26, and 27, which are consistent with the target band size.

[0104] 3. Send Sanger for sequencing. Obtain an electropherogram containing doublets, such as image 3 shown.

[0105] 4. Use our self-written software to type HLA-B:

[0106] The obtained candidate sequences have the following combinations:

[0107] Type 1B*58:41; B*40:49

[0108] Type 2B*58:61; B*40:8...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a kit and method for typing an HLA gene. The kit comprises a primer for amplifying a second exon and a third exon of an HLA-B gene and a primer for amplifying a fourth exon of the HLA-B gene, wherein the primer for amplifying the second exon and the third exon of the HLA-B gene comprises an amplification primer pair composed of primer sequences as shown in SEQ ID NO.1 and SEQ ID NO.2; and the primer for amplifying the fourth exon of the HLA-B gene comprises an amplification primer pair composed of primer sequences as shown in SEQ ID NO.3 and SEQ ID NO.4. By using the kit and method provided by the invention, the typing process can be simpler, the typing resolution ratio and accuracy rate are increased while the cost is reduced, and furthermore the kit and method are further applied to scientific research and clinic work.

Description

technical field [0001] The invention relates to a kit and a method, in particular to a kit and a method for HLA genotyping. Background technique [0002] There is a method for HLA genotyping by PCR amplification combined with Sanger sequencing. Taking HLA-B genotyping as an example, the implementation plan of this method: first, design specific primers to amplify the No. 2 and No. 3 exons of the HLA-B gene. In order to avoid the bias of the primers, generally design multiple pairs of primers . Secondly, the PCR product was sequenced by Sanger sequencing technology, and the sequencing result containing biallelic information was obtained. Furthermore, the data is analyzed through the company's special software (technical parameters are confidential), so as to obtain the HLA-B typing results of the samples, with a resolution ranging from 4 to 6 digits. [0003] The shortcoming of above-mentioned technique has the following points (taking HLA-B genotyping as example): 1, PCR ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/11C12Q1/68
Inventor 贝锦新冯丽娜左晓宇刘稳升
Owner SUN YAT SEN UNIV CANCER CENT
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More