Unlock instant, AI-driven research and patent intelligence for your innovation.

Rapid qualitative and quantitative detection kit for enterococcus faecium in feed as well as detection method and application

A technology for quantitative detection of Enterococcus faecium, applied in the direction of microbial determination/testing, biochemical equipment and methods, etc., can solve the problem that qualitative and quantitative detection methods are not scientific and fast enough, limit the development of probiotic preparations, and consume a lot of time and effort Resources and other issues, to achieve the effect of low detection standards, high sensitivity, and good accuracy

Active Publication Date: 2016-02-17
SHENZHEN JINXINNONG FEED +3
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, probiotic preparations continue to develop, but the qualitative and quantitative detection methods are not scientific and fast enough, which limits the development of probiotic preparations to a certain extent.
Usually, the traditional methods of physiological and biochemical reactions and selective medium pure culture isolation and counting are very easy to limit the detection efficiency and unstable detection results due to differences in bacterial species. In addition, traditional methods will also consume a lot of time and effort. resource

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rapid qualitative and quantitative detection kit for enterococcus faecium in feed as well as detection method and application
  • Rapid qualitative and quantitative detection kit for enterococcus faecium in feed as well as detection method and application
  • Rapid qualitative and quantitative detection kit for enterococcus faecium in feed as well as detection method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Selection of target detection genes for Enterococcus faecium:

[0027] The present invention is effective for other probiotics such as Lactobacillus acidophilus, Lactobacillus bulgaricus, Lactobacillus plantarum, Lactobacillus bulgaricus, Lactobacillus casei, Enterococcus faecalis, Bifidobacterium, etc. A large number of comparisons and analyzes were carried out to select the target gene for qualitative and quantitative detection. The target gene is a conserved housekeeping gene in the genome of Enterococcus faecium, and it is a single-copy gene. The conserved sequence of the gene was designed Specific primers are used for qualitative and quantitative detection of Enterococcus faecium in feed, and the obtained data can truly reflect the quantity of Enterococcus faecium added in feed. The primers designed for the target gene are: 5'-GCGTCCAAGTTATTTTCCCATTTAC-3', 5'-CGATTCCTGACATCTTTCAACACA-3', which can be used for qualitative and quantitative detection of Enterococcus f...

Embodiment 2

[0029] Rapid qualitative and quantitative detection kit for Enterococcus faecium added in feed, including primers: 5'-GCGTCCAAGTTATTTTCCCATTTAC-3', 5'-CGATTCCTGACATCTTTCAACACA-3.

Embodiment 3

[0031] The detection method for the rapid qualitative and quantitative detection kit of Enterococcus faecium added in feed, including the method for pretreatment of feed samples, the method includes:

[0032] Mix 25g of the fully pulverized and homogeneous feed with 225mL of sterilized physiological saline, shake at 4°C for 1-2h at a speed of 100 rpm, and prepare a 10% uniform dilution. Aseptically perform 10-fold incremental dilution on the homogeneous dilution prepared in the previous step, select more than 2 to 3 appropriate dilutions, and extract bacterial genomic DNA or RNA as needed.

[0033] The remaining steps utilize the primers in Example 1 to carry out qualitative and quantitative identification of the extracted DNA or RNA. The detection method for the rapid qualitative and quantitative detection kit of Enterococcus faecium added in the feed specifically includes the following steps:

[0034] A. Preparation of template DNA

[0035] Aseptically put 25g of feed that...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a rapid qualitative and quantitative detection kit for enterococcus faecium in feed as well as a detection method and an application. By virtue of comparison analysis on the reported enterococcus faecium genome sequence, the invention provides primers 5 minute- GCGTCCAAGTTATTTCCCATTTAC-3 minute and 5 minute- cgattcctgacatcttcaacaca -3 minute for qualitatively and quantitatively detecting enterococcu faecium and also provides a pretreatment method of a feed sample, so that probiotics in the feed can be sufficiently released, and the quantity of the probiotics in the feed can be accurately and actually reflected. On the basis of not culturing probiotics, the enterococcus faecium in pig feed can be simply, rapidly, accurately qualitatively and quantitatively detected, the detection procedure is simple, the detection efficiency is high, the accuracy is good, the sensitivity is high, and the repeatability is good.

Description

technical field [0001] The invention belongs to the technical field of animal husbandry and veterinary medicine. More specifically, the present invention relates to a rapid qualitative and quantitative detection kit, detection method and application of Enterococcus faecium added in feed. Background technique [0002] With the prohibition of antibiotics in animal feed in my country, the development of new green additives has become a hot spot. At present, probiotic preparations are constantly developing, but the qualitative and quantitative detection methods are not scientific and fast enough, which limits the development of probiotic preparations to a certain extent. Usually, the traditional methods of physiological and biochemical reactions and selective medium pure culture isolation and counting are very easy to limit the detection efficiency and unstable detection results due to differences in bacterial species. In addition, traditional methods will also consume a lot of...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12Q1/06C12Q1/04
CPCC12Q1/689
Inventor 吴涛侯永清赵迪丁斌鹰易丹王蕾陈洪波
Owner SHENZHEN JINXINNONG FEED