Gut microbial markers of mental disorders and their application
A technology of intestinal microbes, Prevotella, applied in the field of biotechnology, can solve the problem that the mechanism of influence is not very clear
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] In the example, we recruited 31 persons in the mental disorder group and 32 persons in the healthy control group. Through sequencing and bioinformatics analysis, it was shown that there were different kinds of representative gut microbes between the two groups in terms of the number of detected genes, gut microbial species diversity and different taxonomic levels. The main differences at the genus level between the two groups were in several microbial markers such as Prevotella and Bacteroides. We took 62 individuals with mental disorders and healthy controls as the training sample set for the model, and collected 10 individuals from the mental disorder group and 10 healthy controls as the validation sample set. The potential gut microbial markers with significant differences between the two groups were found by comparative analysis of the community and functional composition characteristics of human gut microbes in stool samples from the model learning sample set. Sub...
Embodiment 2
[0041] Example 2: PCR amplification and sequencing of 16s rRNA using fecal DNA as a template
[0042] According to the operating instructions of the Illumina MiSeq sequencing platform (Illumina, San Diego, CA), common primers for bacterial hypervariable regions (V1-V3) (forward primer sequence: 5'AGAGTTTGATCCTGGCTCAG3', reverse primer sequence: 5'TTACCGCGGCTGCTGGCAC3') The 16s rRNA gene of the fecal DNA sample was amplified by Barcoded PCR, the amplified product was electrophoresed and the main DNA fragment was recovered and purified to construct a library according to the experimental requirements of the sequencing company. The library constructed in the above examples was subjected to PE2×150bp sequencing according to the operation guide of the Illumina Miseq sequencing platform.
Embodiment 3
[0043] Example 3: Basic processing of sequencing data
[0044] Each sample produced an average of 74620 original sequences with an average length of 253bp. Using QIIME (Quantitative Insights Into Microbial Ecology, http: / / qiime.org) software (Caporaso, J.G., J. Kuczynski, J. Stombaugh, K. Bittinger, F.D. Bushman, E.K. Costello, et al. (2010): QIIME allows analysis of high-throughput community sequencing data.NatureMethods.7(5):335-336.) processed the sequencing data, and after quality control, a total of 2,514,535 high-quality sequences were obtained after removing low-quality sequences and chimeras (BJ, H. , G.D, E.AM, F.M, W.DV, G.G, et al. (2011): Chimeric16S rRNA sequence formation and detection in Sanger and 454-pyrosequenced PCRamplicons. Genome Res. 21(3):494-504.).
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


