Gut microbial markers of mental disorders and their application

A technology of intestinal microbes, Prevotella, applied in the field of biotechnology, can solve the problem that the mechanism of influence is not very clear

Active Publication Date: 2020-07-14
金锋 +1
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, so far, the specific impact mechanism is not very clear, and the composition and phylogenetic mechanism of the intestinal flora still need further research

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gut microbial markers of mental disorders and their application
  • Gut microbial markers of mental disorders and their application
  • Gut microbial markers of mental disorders and their application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] In the example, we recruited 31 persons in the mental disorder group and 32 persons in the healthy control group. Through sequencing and bioinformatics analysis, it was shown that there were different kinds of representative gut microbes between the two groups in terms of the number of detected genes, gut microbial species diversity and different taxonomic levels. The main differences at the genus level between the two groups were in several microbial markers such as Prevotella and Bacteroides. We took 62 individuals with mental disorders and healthy controls as the training sample set for the model, and collected 10 individuals from the mental disorder group and 10 healthy controls as the validation sample set. The potential gut microbial markers with significant differences between the two groups were found by comparative analysis of the community and functional composition characteristics of human gut microbes in stool samples from the model learning sample set. Sub...

Embodiment 2

[0041] Example 2: PCR amplification and sequencing of 16s rRNA using fecal DNA as a template

[0042] According to the operating instructions of the Illumina MiSeq sequencing platform (Illumina, San Diego, CA), common primers for bacterial hypervariable regions (V1-V3) (forward primer sequence: 5'AGAGTTTGATCCTGGCTCAG3', reverse primer sequence: 5'TTACCGCGGCTGCTGGCAC3') The 16s rRNA gene of the fecal DNA sample was amplified by Barcoded PCR, the amplified product was electrophoresed and the main DNA fragment was recovered and purified to construct a library according to the experimental requirements of the sequencing company. The library constructed in the above examples was subjected to PE2×150bp sequencing according to the operation guide of the Illumina Miseq sequencing platform.

Embodiment 3

[0043] Example 3: Basic processing of sequencing data

[0044] Each sample produced an average of 74620 original sequences with an average length of 253bp. Using QIIME (Quantitative Insights Into Microbial Ecology, http: / / qiime.org) software (Caporaso, J.G., J. Kuczynski, J. Stombaugh, K. Bittinger, F.D. Bushman, E.K. Costello, et al. (2010): QIIME allows analysis of high-throughput community sequencing data.NatureMethods.7(5):335-336.) processed the sequencing data, and after quality control, a total of 2,514,535 high-quality sequences were obtained after removing low-quality sequences and chimeras (BJ, H. , G.D, E.AM, F.M, W.DV, G.G, et al. (2011): Chimeric16S rRNA sequence formation and detection in Sanger and 454-pyrosequenced PCRamplicons. Genome Res. 21(3):494-504.).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a mental disorder related intestinal tract microbial marker and application thereof. The intestinal tract microbial marker refers to one or more combinations of intestinal tract microbial florae of Prevotella and Bacteroides. The invention further discloses application of the mental disorder related intestinal tract microbial marker in preparing reagents for diagnosing mental disorders and methods for screening food, probiotics or drugs capable of intervening with mental disorders. Particularly, the methods include comparing proportion of microbial florae of Prevotella to microbial florae of Bacteroides before and after treatment or interference of the food, probiotics or drugs and / or comparing relative quantity of microbial florae of Prevotella and microbial florae of Bacteroides in feces specimens.

Description

technical field [0001] The invention relates to the fields of biotechnology, disease diagnosis and biomedicine, in particular to microbial markers for mental disorders and applications thereof. Background technique [0002] Mental disorders are a syndrome of important cognitive, emotional, behavioral and other psychological disorders, which can cause individual disorders, pain, and even disability. Common mental disorders are mainly manifested as dementia, depression, anxiety, mania, delusions, hallucinations, affective disorders, strange behavior, and split personality. It is estimated that about one in four people will experience at least one mental disorder in a year, and about 450 million people worldwide suffer from mental health effects. According to statistics in 2009, the global annual cost of mental disorders exceeds 2.5 trillion US dollars, and by 2030 it will exceed 6 trillion US dollars. It has become an important economic and social burden on individuals, fami...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6883C12Q1/689C12Q1/06C12N1/20A61K45/00A61P25/18A23L33/135C12R1/01
CPCA23V2002/00A61K45/00C12Q1/6883C12Q1/689C12Q2600/106C12Q2600/136A23V2200/30A23V2200/3204
Inventor 金锋段云峰
Owner 金锋
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products