Sequence capture method using specialized capture probes (heatseq)

A probe, sequence technology, applied in the field of sequence capture using specialized capture probes (HEATSEQ)

Inactive Publication Date: 2016-09-28
F HOFFMANN LA ROCHE & CO AG
View PDF7 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Currently, hybridization-based techniques that utilize double-stranded adapter-ligated sequencing libraries as input for target capture are time-consuming and resource-intensive
Traditional Molecular Inversion Probe (MIP)-based approaches to achieve target capture can reduce workflow time prior to sequencing, but suffer due to locus amplification / representation bias, allelic bias, and systematic artifacts associated with specific sequencing platforms ( systematic artifact)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Sequence capture method using specialized capture probes (heatseq)
  • Sequence capture method using specialized capture probes (heatseq)
  • Sequence capture method using specialized capture probes (heatseq)

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0061] Example 1: MIP probe library production and purification

[0062] exist figure 1 A protocol for converting MIP-precursors to MIPs is detailed in . figure 1 A shows an example for a MIP-precursor molecule. In this example, the MIP precursor was formed by synthesis on the MAS unit such that the precursor was formed on the array surface. The MIP precursor molecule in this example contains two 15 mer primer sites on the 5' and 3' ends. Near the end primer site there are two 20 mer sites X20 and Y20 that are target-specific regions that are complementary to a specific site that is a border for a specific target region in the sample. Between X20 and Y20 is a linker region, in this case a 30 mer sequence, which joins the two target-specific sequences together.

[0063] The MIP precursor was then amplified using two primers, in this case shown in figure 1 in B. There are both forward and reverse primers. The forward primer contains the same sequence as seen on the...

Embodiment 2

[0069] Example 2 : Use of the MIP probe library to capture regions of interest

[0070] The protocol from Example 1 above will generate a 70-mer MIP that can be used for hybridization to genomic DNA. For the purposes of these examples, this collection was named MIP480 mix. It is also readily recognized that such MIPs can be prepared for use with other forms of nucleic acid targets, including cDNA, RNA, etc. exist image 3 The hybridization and extension steps are depicted in , where MIP probes are contacted with genomic DNA.

[0071] In this example, approximately 750 ng of hgDNA or 2.25 x 105 hgDNA copies were used. Keeping the MIP:genome equivalent ratio at approximately 100:1, use 1 pg of each probe (500 pg = 0.5 ng of MIP480 mix). These MIP calculations assume that only 70 nucleotide MIP fragments are present. For hybridization reactions, use the following reagents:

[0072] Reagent volume 263 ng / µl Genomic DNA (Female, Promega) 3 µl 790 ng...

Embodiment 3

[0083] Example 3 : MIP protocol for exon trapping using 474 MIPs of variable length (20-30 nucleotides) with X and Y with equilibrated melting temperature (Tm).

[0084] In this example, the MIP probes utilized had variable X and Y region lengths, between 20-30 nucleotides. In this embodiment, Tm is calculated using a standard formula such that the X and Y melting temperatures are nearly equal.

[0085] In the previous examples, MIP probes were prepared with a fixed-length 20-nucleotide target-specific region represented as follows:

[0086] 5'-(X20)AGATCGGAAGAGCACATCCGACGGTAGTGT(Y20), where X and Y represent two 20 nucleotide long target-specific regions. In this embodiment, a MIP probe has a variable region that can be represented as follows:

[0087] 5'-(X20-30) AGATCGGAAGAGCACATCCGACGGTAGTGT (Y20-30), wherein the X region and the Y region do not necessarily have the same length. exist Figure 5 Tm distributions of fixed-length 20-nucleotide probes and Tm-balanced 2...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention is a novel protocol for the massively parallel production of improved MIPs. The molecular improvements to the MIP cover the manufacturing of the probes, the workflow, the addition of unique sequence elements which connote sample specificity, and a sequence tag which uniquely identifies a specific molecule present in the initial sample population. Lastly, this invention also is combined with an empirical optimization strategy that overcomes issues of both locus representation and allelic bias. This improved technique is scalable and can be utilized to amplify targets comprised of a single locus' amplicon up to targeting more than 1 million loci.

Description

Background technique [0001] The present invention relates to the field of methods for capturing target regions of genomic or complex DNA samples to enable efficient testing and / or detection of genetic polymorphisms found within said target regions. Methods to efficiently capture target regions of the genome can enable rapid sequencing-mediated discovery and detection of genetic polymorphisms or other traits associated with disease or other traits. Currently, hybridization-based techniques that utilize double-stranded adapter-ligated sequencing libraries as input for target capture are time-consuming and resource-intensive. Traditional Molecular Inversion Probe (MIP)-based approaches to achieve target capture can reduce workflow time prior to sequencing, but suffer due to locus amplification / representation bias, allelic bias, and systematic artifacts associated with specific sequencing platforms ( systematic artifact) are limited. Summary of the invention [0002] The pres...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/28
CPCC12Q1/6813C12Q2525/161C12Q2525/179C12Q2537/159C12Q2563/179C12Q1/6874C12Q1/6876
InventorT.艾伯特J.诺顿J.帕特尔D.布格斯V.莱米切夫M.布罗克曼
OwnerF HOFFMANN LA ROCHE & CO AG