Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Isoprene synthase gene and its application

A technology for isoprene and isoprene production, which is applied to isoprene synthase gene and its application field, and can solve the problem of low isoprene efficiency and the like

Active Publication Date: 2020-12-25
INST OF MICROBIOLOGY - CHINESE ACAD OF SCI +1
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The present invention aims to solve the technical problem that the efficiency of synthesizing isoprene by engineering bacteria is not high, and provides an isoprene synthase gene with higher synthesis efficiency and its application.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Isoprene synthase gene and its application
  • Isoprene synthase gene and its application
  • Isoprene synthase gene and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Embodiment 1: Obtaining of gene fragments

[0029] 1. Extraction of total RNA from leaves of Amorpha fruticosa

[0030] Collect Amorpha fruticosa leaves, use RNeasy Plant Mini Kit (Qiagen Company) to extract total RNA from Amorpha fruticosa leaves, perform electrophoresis according to the kit instructions ( figure 1 ) to verify the quality of RNA extraction, it can be seen that the integrity of the RNA is good, and subsequent experiments can be performed.

[0031] 2. RT-PCR

[0032] Take Oligo(dT) 20 As a reverse transcription primer, the nucleic acid was reverse transcribed into cDNA according to the reverse transcription kit SuperScript.III First-Strand Synthesis System for RT-PCR (Invitrogen Company) instructions;

[0033] The reaction system is as follows:

[0034] RNA 1 μg

[0035] 10mM dNTP 1μl

[0036] Oligo(dT)20 (0.5μg / μl) 1μl

[0037] 65°C for 5min, place on ice for 1min, add the following 10μl mix

[0038]

[0039] 50°C for 50min, 85°C for 15min, a...

Embodiment 2

[0057] Example 2: Obtaining the full length of the coding region of the AfIspS gene

[0058] The method for obtaining full-length cDNA is SMARTer-RACE, using PCR cDNA Synthesis Kit (Clontech Company) was carried out, and the primers and reagents used below were all except GSP Provided in the PCR cDNA SynthesisKit, follow the kit instructions.

[0059] 1. Preparation of RACE-Ready cDNA

[0060] The reverse transcription system for the first strand of RACE-Ready cDNA is as follows:

[0061]

[0062]

[0063] 2. Design of gene-specific primers:

[0064] Design gene-specific primers (GSP) according to the sequence of the obtained AfIspS fragment, use RACE-Ready cDNA as a template, and use GSP and Universal Primer (Universal Primer Mix, UPM) as primers for amplification to obtain 3'-RACEcDNA fragments and 5 '-RACE cDNA fragment. Primer position as Figure 6 As shown, the black part in the middle is the sequence obtained by degenerate PCR, the black part on both sides ...

Embodiment 3

[0087] Embodiment 3: Construction of Escherichia coli isoprene production strain

[0088] The sequences of the full-length primers ZSHFa and ZSHRa are as follows:

[0089] ZSHFa: 5'GTCATGCCATGGGGTGTGCATTGAGCACACAGGATACTC 3'

[0090] ZSHRa: 5' TATCGAGCTCTTCTGCAATTAATTGGAATAGGGTCAAG 3'

[0091] 1. Construction of Escherichia coli expression vector pBAD-AfIspS

[0092] The AfIspS gene fragment obtained using primers ZSHFa and ZSHRa was subjected to NcoI and KpnI double digestion with NcoI and KpnI (TAKARA Company), and the pBAD-HisB expression vector (purchased from Invitrogen Company) was subjected to NcoI and KpnI double digestion, and the AfIspS gene was connected to pBAD- The HisB vector was transformed into trans5α competent cells, and positive clones were selected for sequencing. The nucleotide sequence of pBAD-AfIspS is SEQ ID No.5.

[0093] 2. Construction of isoprene-producing strain MV / pAfispS

[0094] The constructed pBAD-AfIspS and plasmids p1 and p2 were co-trans...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an isoprene synthetase gene and applications of the isoprene synthetase gene, for solving the technical problem that the efficiency for synthesizing isoprene by adopting engineering bacteria is not high. The invention provides the isoprene synthetase gene, protein expressed by the isoprene synthetase gene, a prokaryotic expression vector containing the isoprene synthetase gene, engineering bacteria, as well as preparation method and applications of the engineering bacteria capable of producing isoprene. The isoprene synthetase gene can be widely applied to the preparation field of isoprene.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to an isoprene synthase gene and its application. Background technique [0002] In nature, isoprene is mainly emitted into the atmosphere by certain plant leaves, while in industrial production, isoprene is mainly extracted and distilled from the C5 fraction of petroleum cracking products. However, as petroleum resources are increasingly depleted and non-renewable, the collection of isoprene released by natural plants is getting twice the result with half the effort. The production of isoprene through microbial engineering bacteria has become an inevitable trend of sustainable development. [0003] According to reports, plants release 5 million tons of isoprene into the atmosphere every year, and bacteria themselves do not have isoprene synthase genes, so plants are a good source of isoprene synthase (ISPS). Some progress has been made in the study of isoprene synthase ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/60C12N9/88C12N15/70C12N15/81C12N1/21C12N1/19C12P5/02C12R1/19C12R1/865
Inventor 李春赖小勤胡开蕾毋鸿江傅深展陶勇
Owner INST OF MICROBIOLOGY - CHINESE ACAD OF SCI
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More