Unlock instant, AI-driven research and patent intelligence for your innovation.

Isoprene synthase gene and application thereof

A technology of isoprene and synthase, applied in the field of genetic engineering, can solve the problem of low efficiency of isoprene

Inactive Publication Date: 2016-10-05
INST OF MICROBIOLOGY - CHINESE ACAD OF SCI
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The present invention aims to solve the technical problem that the efficiency of synthesizing isoprene by engineering bacteria is not high, and provides an isoprene synthase gene with higher synthesis efficiency and its application.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Isoprene synthase gene and application thereof
  • Isoprene synthase gene and application thereof
  • Isoprene synthase gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1: Preparation of RACE-Ready cDNA

[0027] 1. Extraction of total RNA from oak leaves

[0028] Collect oak leaves, use RNeasy Plant Mini Kit (Qiagen Company) to extract total RNA from poplar leaves, perform electrophoresis according to the kit instructions ( figure 1 ) to verify the quality of RNA extraction, it can be seen that the integrity of the RNA is good, and subsequent experiments can be performed.

[0029] 2. Preparation of RACE-Ready cDNA

[0030] The method for obtaining full-length cDNA is SMARTer-RACE, using PCR cDNASynthesis Kit (Clontech Company) was carried out, and the primers and reagents used below were all except GSP Provided in the PCR cDNA Synthesis Kit, follow the kit instructions.

[0031] The reverse transcription system for the first strand of RACE-Ready cDNA is as follows:

[0032]

[0033] 3. Design of gene-specific primers:

[0034] According to the conserved regions of the known amino acid sequences of Salicaceae and Legu...

Embodiment 2

[0037] Example 2: Obtaining the full length of the QaIspS gene coding region

[0038] 1. Obtaining the end sequence of 3'-RACE cDNA

[0039] Use the 3'-RACE-Ready cDNA of Quercus quercus as a template, UPM and GSP as primers for amplification

[0040] reaction system:

[0041]

[0042]

[0043] Reaction conditions:

[0044]

[0045] The agarose gel detection results of 3'-RACE are shown in the figure ( figure 2 ):

[0046] Obtain a single bright Quercus quercus DNA amplified band, connect T vector, transform competent cells, select positive clones for Sanger sequencing, and obtain the 3' end cDNA sequence.

[0047] 2. Obtaining the end sequence of 5'-RACE cDNA

[0048] The 5'-RACE-Ready cDNA of Quercus quercus was used as a template, and UPM and GSP were used as primers for amplification.

[0049] reaction system:

[0050]

[0051]

[0052] Reaction conditions:

[0053]

[0054] The agarose gel detection results of 5'-RACE are shown in the figure ( i...

Embodiment 3

[0058] Embodiment 3: Construction of Escherichia coli isoprene production strain

[0059] The sequences of full-length primers QAFa and QARa are as follows:

[0060] QAFa: 5'AATTAACCATGGCGAGCAAACAAGTGC 3'

[0061] QARa: 5' ATATGGTACCCTAAAGGTGGATCTGGCTG 3'

[0062] 1. Construction of Escherichia coli expression vector pBAD-QaIspS

[0063] The QaIspS gene fragment obtained using primers QAFa and QARa was subjected to NcoI and KpnI double digestion with NcoI and KpnI (TAKARA Company), and the pBAD-HisB expression vector (purchased from Invitrogen Company) was subjected to NcoI and KpnI double digestion, and the QaIspS gene was connected to pBAD- The HisB vector was transformed into trans5α competent cells, and positive clones were selected for sequencing. The nucleotide sequence of pBAD-QaIspS is SEQ ID No.5.

[0064] 2. Construction of isoprene producing strain MV / pQaIspS

[0065] The constructed pBAD-QaIspS and plasmids p1 and p2 were co-transformed into the BW25113 host to...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an isoprene synthase gene and an application thereof, in order to solve the technical problem that the synthesis of isoprene, with the adoption of engineering bacteria, is not high in efficiency. The invention provides the isoprene synthase gene, protein expressed by the isoprene synthase gene, a prokaryotic expression vector and an engineering bacterium containing the isoprene synthase gene as well as a preparation method for producing the isoprene engineering bacterium and an application of the isoprene engineering bacterium. The isoprene synthase gene disclosed by the invention can be widely applied to the field of preparing the isoprene.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to an isoprene synthase gene and its application. Background technique [0002] In nature, isoprene is mainly emitted into the atmosphere by certain plant leaves, while in industrial production, isoprene is mainly extracted and distilled from the C5 fraction of petroleum cracking products. However, as petroleum resources are increasingly depleted and non-renewable, the collection of isoprene released by natural plants is getting twice the result with half the effort. The production of isoprene through microbial engineering bacteria has become an inevitable trend of sustainable development. [0003] According to reports, plants release 5 million tons of isoprene into the atmosphere every year, and bacteria themselves do not have isoprene synthase genes, so plants are a good source of isoprene synthase (ISPS). Some progress has been made in the study of isoprene synthase ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/60C12N9/88C12N15/70C12N1/21C12P5/02C12R1/19
Inventor 李春赖小勤冯凡傅深展陶勇
Owner INST OF MICROBIOLOGY - CHINESE ACAD OF SCI