Unlock instant, AI-driven research and patent intelligence for your innovation.

Bean pod mottle virus LAMP primer, kit and detection method

A technology for mottle virus and detection method, which is applied in the field of detection kits for bean pod mottle virus, including the above primers, can solve the problems of difficult to achieve sensitivity, low detection sensitivity, low toxicity rate and the like, and achieves low detection cost and wide Application prospect, high sensitivity effect

Inactive Publication Date: 2016-12-14
陈定虎
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, the detection methods of plant viruses mainly include biology, serology and molecular biology. The biological method is to use the virus indicator plant to detect the presence or absence of the virus, which generally takes 7-10 days; the serological method is based on the antigen-antibody Generally, it only takes about 4-6 hours to detect the virus, but it requires specific antiserum, and the detection sensitivity is not high, and there are still non-specific problems; molecular biology methods mainly refer to the PCR method. The method is fast and has high accuracy, but requires expensive detection instruments and related equipment, and for viruses like BPMV, because of its very low infection rate, a detection method with very high sensitivity is required to detect potential BPMV. The sensitivity of the above three methods is difficult to achieve, so there will be a possibility of missed detection, so it is urgent to study new detection methods

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bean pod mottle virus LAMP primer, kit and detection method
  • Bean pod mottle virus LAMP primer, kit and detection method
  • Bean pod mottle virus LAMP primer, kit and detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0085] A kind of bean pod mottle virus LAMP primer of the present invention comprises:

[0086] Forward outer primer F3: 5'CAGGAAAAAGTTGTGCTGAA3';

[0087] Reverse outer primer B3: 5'GCACATATTTTCTATGATCGTCA3';

[0088] Forward internal primer FIP:

[0089] 5'CAGCAAGGTTGTTGCAGGAC-TTTCACAAGAGGAGTTTCTCA C3';

[0090] Wherein said forward inner primer FIP comprises F1c and F2:

[0091] F1c: 5'CAGCAAGGTTGTTGCAGGAC3';

[0092] F2: 5'TTTCACAAGAGGAGTTTCTCAC3';

[0093] Reverse inner primer BIP:

[0094] 5'TGGGTGCCCATATTTGTATGC-TTGACACCAATAACAAAATCAC3';

[0095] Wherein the reverse inner primer BIP includes B1c and B2:

[0096] Where B1c: 5'TGGGTGCCCATATTTGTATGC3';

[0097] B2: 5'TTGACACCAATAACAAAATCAC3'.

Embodiment 2

[0099] A kind of bean pod mottle virus LAMP test kit of the present invention, this test kit comprises:

[0100]

[0101] Wherein said primers include:

[0102] Forward outer primer F3: 5'CAGGAAAAAGTTGTGCTGAA3';

[0103] Reverse outer primer B3: 5'GCACATATTTTCTATGATCGTCA3';

[0104] Forward internal primer FIP:

[0105] 5'CAGCAAGGTTGTTGCAGGAC-TTTCACAAGAGGAGTTTCTCAC3';

[0106] Wherein said forward inner primer FIP comprises F1c and F2:

[0107] F1c: 5'CAGCAAGGTTGTTGCAGGAC3';

[0108] F2: 5'TTTCACAAGAGGAGTTTCTCAC3';

[0109] Reverse inner primer BIP:

[0110] 5'TGGGTGCCCATATTTGTATGC-TTGACACCAATAACAAAATCAC3';

[0111] Wherein the reverse inner primer BIP includes B1c and B2:

[0112] Where B1c: 5'TGGGTGCCCATATTTGTATGC3';

[0113] B2:5'TTGACACCAATAACAAAATCAC3';

[0114] Wherein the product specification of the kit: 40 times.

[0115] The primers include 1.6 μl forward outer primer F3, 1.6 μl reverse outer primer B3, 0.2 μl forward inner primer FIP, and 0.2 μl revers...

Embodiment 3

[0121] A kind of bean pod mottle virus LAMP detection method of the present invention comprises the following steps:

[0122] A. Extract sample RNA;

[0123] B. Establish a LAMP reaction system:

[0124] Take various reagents from the kit according to the reaction volume required for the detection, put them into sterilized test tubes, and prepare the premix solution on ice; flick the sterilized test tube to mix well, and centrifuge for a few seconds to concentrate the solution in the sterilized test tube. Bottom of tube; 20 μL LAMP reaction consisting of:

[0125]

[0126] C. Adding samples:

[0127] Add 5 μL each of the sample RNA to be tested, the negative control reaction sample, and the positive control reaction sample to three sterilized test tubes containing 20 μL LAMP reaction body, so that the total amount of each reaches 25 μL, cover the test tube cap and tap Mix and briefly centrifuge to concentrate the reaction solution at the bottom of the sterilized test tub...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses a bean pod mottle virus LAMP primer, a kit and a detection method. The primer comprises a forward outer primer F3, a backward outer primer B3, a forward inner primer FIP and a backward inner primer BIP. One object of the invention is to provide the bean pod mottle virus LAMP primer in order to overcome the defects in the prior art; another object of the invention is to provide the kit containing the primer; another object of the invention is to provide the method for detecting the bean pod mottle virus by using the kit; the detection method has the characteristics of high primer specificity, simple equipment, high speed, high detection sensitivity, closed pipe detection, simple operation and the like, and the result can be judged and read directly.

Description

technical field [0001] The present invention relates to a LAMP primer for bean pod mottle virus, and also relates to a kit including the above primer; the present invention also relates to a method for detecting bean pod mottle virus by using the above kit. Background technique [0002] Bean pod mottle virus 5'TTGACACCAATAACAAAATCAC3', BPMV is a quarantine pest that enters my country. It belongs to the family Comoviridae and the genus Comovirus. The main carrier is Cerotoma trifurcata. It is widely distributed in the Americas and Asia. After soybeans are infected by it, the leaves are mottled, shrunk, pods and seeds are mottled, even necrotic, and the plants die. It can also delay the maturity of soybean stems and cause the phenomenon of "green stems", which can cause In the loss of 3% to 52.4%, if it is co-infected with soybean mosaic virus, the yield loss can reach 66%, and the mottled rate of seeds increases, which affects product quality. The BPMV particle is an equiaxed ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11C12R1/94
CPCC12Q1/701C12Q1/6844C12Q2531/119C12Q2545/113C12Q2563/107
Inventor 陈定虎管维
Owner 陈定虎