Application of GmGAPC1 gene segment as reference gene stably expressed in different growth periods of gentiana macrophylla
A gene fragment and growth period technology, applied in the field of molecular biology, can solve problems such as changes in the expression of internal reference genes
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] The GmGAPC1 gene fragment was used as an internal reference gene of Gentiana in different growth stages, and the GmWRKY gene fragment (nucleotide sequence: CAGATTCGGAAGCATGTGAATTATGATTATTTCCTATGATTCTTGCACCGAAGTAGTTTGATCCAGAAGTTGCAGGAGACATCAAAGAAGGACATGGATTTCCTCCAAAATCATTTTCCATTACCATAGAAGAAGATCCTCAAATATTGGAAAACTTCCAAAATCC) was used as the target gene detection method as follows:
[0026] 1. Extract total RNA from Gentiana chinensis
[0027] Take fresh annual roots, stems, leaves, and 2-leaf, 4-leaf, and 6-leaf samples of fresh Gentiana chinensis and put them into 1.5mL centrifuge tubes, put them into liquid nitrogen for quick freezing, and then place them in a RNase-removing A sufficient amount of liquid nitrogen was added to the mortar to grind the sample into a powder; the total RNA of the sample was extracted using the Polysaccharide and Polyphenol Plant Total RNA Rapid Extraction Kit of Biotek Biological Company according to the instructions.
[0028] 2. Synthesis of G...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com