Application of GmGAPC1 gene segment as reference gene stably expressed in different growth periods of gentiana macrophylla

A gene fragment and growth period technology, applied in the field of molecular biology, can solve problems such as changes in the expression of internal reference genes

Inactive Publication Date: 2017-01-11
SHAANXI NORMAL UNIV
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, more and more experimental studies have found that some commonly used internal reference genes are not stabl...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of GmGAPC1 gene segment as reference gene stably expressed in different growth periods of gentiana macrophylla
  • Application of GmGAPC1 gene segment as reference gene stably expressed in different growth periods of gentiana macrophylla
  • Application of GmGAPC1 gene segment as reference gene stably expressed in different growth periods of gentiana macrophylla

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] The GmGAPC1 gene fragment was used as an internal reference gene of Gentiana in different growth stages, and the GmWRKY gene fragment (nucleotide sequence: CAGATTCGGAAGCATGTGAATTATGATTATTTCCTATGATTCTTGCACCGAAGTAGTTTGATCCAGAAGTTGCAGGAGACATCAAAGAAGGACATGGATTTCCTCCAAAATCATTTTCCATTACCATAGAAGAAGATCCTCAAATATTGGAAAACTTCCAAAATCC) was used as the target gene detection method as follows:

[0026] 1. Extract total RNA from Gentiana chinensis

[0027] Take fresh annual roots, stems, leaves, and 2-leaf, 4-leaf, and 6-leaf samples of fresh Gentiana chinensis and put them into 1.5mL centrifuge tubes, put them into liquid nitrogen for quick freezing, and then place them in a RNase-removing A sufficient amount of liquid nitrogen was added to the mortar to grind the sample into a powder; the total RNA of the sample was extracted using the Polysaccharide and Polyphenol Plant Total RNA Rapid Extraction Kit of Biotek Biological Company according to the instructions.

[0028] 2. Synthesis of G...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses application of a GmGAPC1 gene segment as a reference gene stably expressed in different growth periods of gentiana macrophylla. The GmGAPC1 gene segment is adopted as the reference gene of the gentiana macrophylla in different growth periods, fluorescent quantitative PCR technical detection shows that the gene segment can be used as a reference in different growth periods such as two-leaves period, four-leaves period, six-leaves period and roots, stems and leaves of an annual plant, and a foundation is laid for studying a functional gene of gentiana macrophylla and expression of a key enzyme gene of a metabolic pathway of a secondary metabolite, namely gentiopicroside.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and specifically relates to the application of a GmGAPC1 gene fragment as an internal reference gene stably expressed in different growth stages of the traditional Chinese medicine Gentiana chinensis. Background technique [0002] The traditional Chinese medicine Gentiana chinensis is a precious traditional Chinese medicine in my country. It has the functions of dispelling rheumatism, clearing damp-heat, relieving numbness and pain, harmonizing blood, relaxing tendons, and diuresis. With the development of society, the increasing market demand year by year, as well as random digging and other reasons, the wild Gentiana resources have been greatly damaged. Since 1987, Gentiana chinensis has been listed as a third-level key protected wild medicinal material in my country. The active ingredients of Gentiana are mainly Secoiridiodglycosides represented by gentiopicroside, and also include ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/68
CPCC12Q1/6895C12Q2600/158C12Q2600/166
Inventor 王喆之何懿菡强毅
Owner SHAANXI NORMAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap