Artificial fixed-point rice dense and erect panicle (DEP1) gene mutant body and application thereof
A technique of erecting dense ears and site-directed mutation, applied in genetic engineering, application, climate change adaptation, etc., can solve the problem of uncertainty of high yield effect, maximum potential, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] The base sequence of the DEP1 gene is shown in SEQ ID NO.8.
[0031] The base sequence of exon 5 (wild type) of DEP1 gene is shown in SEQ ID NO.9, see Figure 8 .
[0032] In this example, based on CRISPR / Cas9 technology, the target of exon 5 of DEP1 gene was designed, and two targets AGCTGCGGTTGCAACGGCTG with close and consistent sequences were selected, and the first target was located at base 499-519 of exon 5 base, and the second target is located at the 530-549th base of exon 5. In this example, the target sequence is synthesized,
[0033] Oligo15'- GGCA AGCTGCGGTTGCAACGGCTG-3',
[0034] Ologo2: 5'-AAACAGCTGCGGTTGCAACGGCTG-3'.
[0035] In this example, the binary vector Pcambia1300 containing the cas9 expression cassette (35S promoter) and the guid RNA expression cassette (rice OsU3 promoter) was used as the backbone vector for vector construction, and the target sequence was inserted into the backbone vector. The specific method is as follows: Anneal and ph...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



