A recombinant plasmid that can be used to package a large amount of exogenous proteins and its construction method and application
A technology for recombining plasmids and foreign proteins, applied in the biological field, can solve problems such as low packaging efficiency and genetic instability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] A recombinant plasmid capable of packaging a large amount of foreign protein, prepared by the following steps:
[0039] 1. AcMNPV Polyhedrin N-terminal and C-terminal acquisition:
[0040] (1) Acquisition of Polyhedrin N-terminal and C-terminal coding fragments: with PHNF (CTA GCTAGC ATGCCGGATTATTCATACCGTC) and PHN 150 R(ACAT GCATGC TTAATGAGGTACATAGTCGGGGTCG) is a primer, and the AcMNPV genomic DNA is a template to amplify the 5' end 450bp of the AcMNPV polyhedrin gene (shown in SEQ ID NO.1). The forward primer and the reverse primer contain a start codon and a stop codon respectively. The PCR reaction conditions were: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 45 s, annealing at 56°C for 30 s, extension at 72°C for 25 s, and 30 cycles; final extension at 72°C for 7 min, and 16°C for 30 min.
[0041] to PHC 95 F (GGAATTCATGGCTAAGCGCAAGAAGGACGTGATTAGGATCGTCGAGC) and PHCR (GCTCTAGAAGATCCACCTCCACCATACGCCGGACCAGTGAAC) as primers, AcMNPV genomic DNA as...
Embodiment 2
[0045] recombinant pD-PhN 150 -PhC 95 Recombinant AcBacmid obtained after plasmid transformation can express complete polyhedrin multimer
[0046] Obtaining of recombinant AcBacmid: pD-PhN 150 -PhC 95 and pD-Ph were respectively transformed into E.coliDH10B (Invitrogen, USA) competent cells ( figure 1 ), then spread on LA medium plate (containing 50 μg / mL Kana, 7 μg / mL Gm, 10 μg / mL Tetra, 100 μg / mL X-gal, 40 μg / mL IPTG), and cultured at 37°C for 48 hours. Check the blue and white spots on the plate, and the white spots are colonies of recombinant Ac Bacmid successfully transposed. Re-streak the white colonies on a fresh LA medium plate and dilute the colonies until the plaques are completely white. Pick white colonies and insert them into liquid medium LB (containing 50 μg / mL Kana, 7 μg / mL Gm, 10 μg / mL Tetra), culture them on a shaker at 37°C and 250 rpm for 15 hours, extract recombinant Ac Bacmid, and name them respectively as AcBac-PhN 150 -PhC 95 ( figure 1 ), and...
Embodiment 3
[0053] pD-PhN 150 -PhC 95 Application of plasmids in expressing foreign proteins:
[0054] (1) PCR amplification of the green fluorescent protein (eGFP) gene egfp: primers GFPF (GCTCTAGAAGTAAAGGAGAAGAACTTTTCACTG) and GFPR (AACTGCAGTTATTTGTATAGTTCATCCATGCC) were used, in which an ATT stop codon was added to the end of GFPR. pEeGFP-N1 (Clontech, Germany) was used as a template to amplify the gfp fragment. The PCR reaction conditions were: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 45 s, annealing at 56°C for 30 s, extension at 72°C for 45 s, and 30 cycles; final extension at 72°C for 7 min, and 16°C for 30 min.
[0055] (2) Construction of recombinant Bacmid: The gfp fragment obtained by PCR was double-digested with XbaI / PstI, and then connected to the pUC18 vector. Using XbaI / PstI double digestion of gfp fragment and pD-PhN after XbaI / PstI double digestion 150 -PhC 95 and pD-Ph (as a control), ligated overnight at 16°C. Transform DH5α competent. Spread ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



