A recombinant plasmid that can be used to package a large amount of exogenous proteins and its construction method and application

A technology for recombining plasmids and foreign proteins, applied in the biological field, can solve problems such as low packaging efficiency and genetic instability

Active Publication Date: 2021-04-20
湖北天勤生物科技有限公司
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This technology has the defects of low packaging efficiency and genetic instability (Shim et al., Applied and Environmental Microbiology, 2013, 79:141-149), so that the recombinant virus constructed using this technology has not been practically applied

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A recombinant plasmid that can be used to package a large amount of exogenous proteins and its construction method and application
  • A recombinant plasmid that can be used to package a large amount of exogenous proteins and its construction method and application
  • A recombinant plasmid that can be used to package a large amount of exogenous proteins and its construction method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] A recombinant plasmid capable of packaging a large amount of foreign protein, prepared by the following steps:

[0039] 1. AcMNPV Polyhedrin N-terminal and C-terminal acquisition:

[0040] (1) Acquisition of Polyhedrin N-terminal and C-terminal coding fragments: with PHNF (CTA GCTAGC ATGCCGGATTATTCATACCGTC) and PHN 150 R(ACAT GCATGC TTAATGAGGTACATAGTCGGGGTCG) is a primer, and the AcMNPV genomic DNA is a template to amplify the 5' end 450bp of the AcMNPV polyhedrin gene (shown in SEQ ID NO.1). The forward primer and the reverse primer contain a start codon and a stop codon respectively. The PCR reaction conditions were: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 45 s, annealing at 56°C for 30 s, extension at 72°C for 25 s, and 30 cycles; final extension at 72°C for 7 min, and 16°C for 30 min.

[0041] to PHC 95 F (GGAATTCATGGCTAAGCGCAAGAAGGACGTGATTAGGATCGTCGAGC) and PHCR (GCTCTAGAAGATCCACCTCCACCATACGCCGGACCAGTGAAC) as primers, AcMNPV genomic DNA as...

Embodiment 2

[0045] recombinant pD-PhN 150 -PhC 95 Recombinant AcBacmid obtained after plasmid transformation can express complete polyhedrin multimer

[0046] Obtaining of recombinant AcBacmid: pD-PhN 150 -PhC 95 and pD-Ph were respectively transformed into E.coliDH10B (Invitrogen, USA) competent cells ( figure 1 ), then spread on LA medium plate (containing 50 μg / mL Kana, 7 μg / mL Gm, 10 μg / mL Tetra, 100 μg / mL X-gal, 40 μg / mL IPTG), and cultured at 37°C for 48 hours. Check the blue and white spots on the plate, and the white spots are colonies of recombinant Ac Bacmid successfully transposed. Re-streak the white colonies on a fresh LA medium plate and dilute the colonies until the plaques are completely white. Pick white colonies and insert them into liquid medium LB (containing 50 μg / mL Kana, 7 μg / mL Gm, 10 μg / mL Tetra), culture them on a shaker at 37°C and 250 rpm for 15 hours, extract recombinant Ac Bacmid, and name them respectively as AcBac-PhN 150 -PhC 95 ( figure 1 ), and...

Embodiment 3

[0053] pD-PhN 150 -PhC 95 Application of plasmids in expressing foreign proteins:

[0054] (1) PCR amplification of the green fluorescent protein (eGFP) gene egfp: primers GFPF (GCTCTAGAAGTAAAGGAGAAGAACTTTTCACTG) and GFPR (AACTGCAGTTATTTGTATAGTTCATCCATGCC) were used, in which an ATT stop codon was added to the end of GFPR. pEeGFP-N1 (Clontech, Germany) was used as a template to amplify the gfp fragment. The PCR reaction conditions were: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 45 s, annealing at 56°C for 30 s, extension at 72°C for 45 s, and 30 cycles; final extension at 72°C for 7 min, and 16°C for 30 min.

[0055] (2) Construction of recombinant Bacmid: The gfp fragment obtained by PCR was double-digested with XbaI / PstI, and then connected to the pUC18 vector. Using XbaI / PstI double digestion of gfp fragment and pD-PhN after XbaI / PstI double digestion 150 -PhC 95 and pD-Ph (as a control), ligated overnight at 16°C. Transform DH5α competent. Spread ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a recombinant plasmid that can be used to package a large amount of foreign proteins and its construction method and application. Based on the formation mechanism of the monomer structure and multimer structure of the baculovirus polyhedrin protein, the polyhedrin protein is truncated to N-terminal 150 aa and 95 aa at the C-terminus, and fused the C-terminus with green fluorescent protein. As for the expression under two different promoters, a recombinant Autographa californica nuclear polyhedrosis virus (AcMNPV) was constructed, which can correctly form inclusions body, and the inclusion body can emit green fluorescence under the fluorescence microscope. In addition, by fusing the C-terminal 95 aa of the polyhedrin protein with the baculovirus enhancer protein Enhancin or GP37, a large amount of expression of these two proteins in AcMNPV inclusion bodies can be detected, and their insecticidal activity is significantly improved.

Description

technical field [0001] The invention belongs to the field of biotechnology, and more specifically relates to a recombinant plasmid capable of packaging a large amount of foreign proteins, a construction method and application. Background technique [0002] In order to improve the infection characteristics of baculovirus, some toxin proteins targeting insects or proteins capable of destroying the insect feeding membrane can be packaged into the inclusion body of the virus in large quantities. The cleavage and release brings other lethal factors to insects besides the virus, which can improve the insecticidal efficiency of the baculovirus. The current technology for packaging foreign proteins into inclusion bodies mainly uses truncated or full-length fragments of Polyhedrin to fuse foreign proteins, and packs foreign proteins into inclusion bodies by interacting with the wild-type Polyhedrin that exists in addition ( Kim et al., Journal of microbiology and biotechnology, 2005...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/866C12N15/66C12N5/10A01N63/50A01N57/16A01P7/04
Inventor 类承凤孙修炼赵丽娟马瑞鹏杨士礼
Owner 湖北天勤生物科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap