Nucleotide sequence regulating maize tocopherol synthesis and its application
A nucleotide sequence and tocopherol technology, applied in the biological field, can solve the problems of the annual output being difficult to meet the market demand and limited output, and achieve the effects of improving the quality of corn oil products, increasing the expression level, and having a large application prospect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0045] The present invention utilizes the experimental platform of the ultra-high performance liquid chromatography in the applicant's laboratory, corn materials with wide diversity and adaptability, the constructed ultra-high-density linkage map, and abundant remaining hybrid materials to conduct tocopherol QTL The initial mapping and fine mapping of maize kernel to analyze the genetic basis of tocopherol.
[0046] The cloning method of the ZmPOR1 gene provided by the present invention is:
[0047] Using the D340×K22F6 population containing 192 materials, the tocopherol content of each material, including α, γ, and δ, was determined by ultra-high performance liquid chromatography, and combined with the high-density linkage map of the population, the QTL was performed with WinQTLcat V2.5 Mapping, chromosome 1 was mapped to a major QTL named qVTE1, which can explain 36% of the genetic variation of γ-tocopherol. The two ends of the confidence interval are marked as PUT-163a-7144...
Embodiment 2
[0050] In order to verify the function of the ZmPOR1 gene, the applicant constructed an overexpression vector containing the gene:
[0051] The full-length sequence of ZmPOR1 gene was amplified in maize inbred line B73 with primer DMp455-F / R:
[0052] DMp455-F:
[0053] CTAGTATCCCGGGAA GGCGCGCC ATGGCGCTCCAGGCCGCGACGTCC, underlined as AcsⅠ
[0054] DMp455-R:
[0055] GAACGATAAGCTTAT GGCGCGCC TCACGCCAAGCCGACGAGCTTCTC, underlined as AcsⅠ
[0056] Based on a 20 μl reaction system, the amplified reaction system includes:
[0057]
[0058] The PCR amplification program is:
[0059]
[0060]
[0061] ⑤ Repeat ②③④ for 34 cycles;
[0062] ⑥72°C for 5 minutes.
[0063] It was connected to the overexpression vector pZZ-EGFP (provided by China Seed Group) through homologous recombination, the expression was driven by the ubiquitin promoter, and the constructed vector was transferred into an excellent maize inbred line C01. Since the vector contains the selection gene b...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


