Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for identifying Ig gene distribution of B lymphocytes by digital PCR (Polymerase Chain Reaction)

A technology of B lymphocytes and genes, applied in the field of identifying the Ig gene distribution of B lymphocytes, can solve the problems of adjustment, influence on analysis accuracy, lack of PCR preference, etc., and achieve more accurate data analysis results, more reliable data analysis results, Reliable effect of data results

Inactive Publication Date: 2017-11-03
SHENZHEN HUADA GENE INST
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the immune library construction technology, it is usually necessary to design multiple pairs of V primers and C primers for multiplex PCR or design multiple C primers for 5'race library construction, which will cause bias in the PCR process and affect the accuracy of subsequent analysis. Especially the analysis of the five Ig ratios
It is impossible to determine whether there is a bias, and it is impossible to know which primers cause the bias. It is impossible to adjust the ratio of primers in a targeted manner.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for identifying Ig gene distribution of B lymphocytes by digital PCR (Polymerase Chain Reaction)
  • Method for identifying Ig gene distribution of B lymphocytes by digital PCR (Polymerase Chain Reaction)
  • Method for identifying Ig gene distribution of B lymphocytes by digital PCR (Polymerase Chain Reaction)

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Embodiment 1, Utilize digital PCR to identify the Ig gene distribution of B lymphocyte

[0037] 1. Technical process

[0038] Such as figure 2 As shown, five sets of primers were first designed according to the C region gene sequences of 5 kinds of Ig, and each set of primers included reverse transcription primers, amplification primers and taqman probes for amplifying C region genes; wherein, the reverse The sequence of the recording primer is the same as that of the downstream primer in the amplification primer. The primer sequences are shown in Table 1 to Table 3.

[0039] Table 1 The reverse transcription primers of the C region gene sequences of 5 kinds of Ig

[0040] IGHER

CCCACGCACCCGAGAC (sequence 1)

IGHMR

GTGAGGTGGCTGCGTACTTGC (sequence 2)

IGHDR

CCACGCATTTGTACTCGC (sequence 3)

IGHAR

GGGCAGGGCACAGTCACATCC (sequence 4)

IGHGR

GGAAGGTGTGCACGCCGCTGGTC (sequence 5)

[0041] Table 2 Amplification prime...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for identifying Ig gene distribution of B lymphocytes by digital PCR (Polymerase Chain Reaction). The method comprises the following steps: 1) designing five sets of primers according to five Ig heavy chain C regions, wherein each set of primers comprises a reverse transcription primer, an amplification primer and / or a taqman probe, and the reverse transcription primer is the same as a reverse primer in the amplification primer; 2) carrying out reverse transcription on 5 identical RNA of the same sample to be tested to generate cDNA, then carrying out digital PCR detection to obtain an original copy number of corresponding Ig genes in the 5 cDNA, and calculating copy number distribution of the 5 Ig genes in the sample to be tested. The method disclosed by the invention can identify the expression of 5 Ig genes and does not have the preference problem, and can reflect the proportion of the 5 Ig in the original sample. The digital PCR technology is used for identifying the Ig gene distribution to verify whether a preference exists in a sequencing result, and the correction of the preference of the primer amplification is facilitated. The accuracy of the Ig ratio is conducive to the research of disease immune response, vaccine evaluation and the like.

Description

technical field [0001] The invention belongs to the field of biotechnology and relates to a method for identifying the Ig gene distribution of B lymphocytes by using digital PCR. Background technique [0002] Digital PCR (Digital PCR, dPCR) technology is a new nucleic acid detection and quantification method, which uses absolute quantification, does not rely on standard curves or reference genes, and has higher sensitivity than traditional Realtime PCR. Samples containing only one target molecule can be measured by diluting and separating micro-samples until each sample contains no more than one molecule to be tested, and then performing PCR amplification on all samples under the same conditions . The dye method or Taqman probe method can be used for PCR amplification, and the results can be analyzed according to the fluorescent signal of the reaction. Due to its absolute quantitative method principle and highly sensitive detection characteristics, dPCR can be applied in d...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6851C12Q2531/113C12Q2561/101C12Q2537/16C12Q2537/143
Inventor 林莉娅武靖华
Owner SHENZHEN HUADA GENE INST
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products