Method for efficiently detecting EGFR T790M mutant, probe and kit for detection

An EGFRT790M, mutant technology, applied in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc., can solve the problem of low ctDNA fragments

Inactive Publication Date: 2017-12-26
GNOMEGEN
View PDF4 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are enormous technical challenges in making cancer blood testing a routinely available technology in clinical practice. The content of ctDNA fragments in blood is very low, and the proportion of tumor DNA is usually <1%, or even only 0.1%. %, it is necessary to develop a detection technology with high sensitivity and specificity, and at the same time it should have the characteristics of simple operation, low cost and high repeatability

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for efficiently detecting EGFR T790M mutant, probe and kit for detection

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1 Mutant capture and real-time quantitative PCR detection

[0037] Materials used:

[0038] 2×EGFR mutant detection solution: 0.2% TritonX-100; 10-20mM MgCl 2 ; 16mM (NH4) 2 SO4; 50mM KCl; 10mM NAD, 40mM Tris-HCl (pH8.0); 0.6M each of the upstream and downstream mutant capture primers, blocking sequence 6M, dTTP 500M, HotTaq enzyme 1.0-3.0U, Ampligase 2.0-5.0U .

[0039] 10x PCR primer and probe solution: PCR upstream and downstream primers 3M each, four dNTPs 5mM each, mutant probe 0.3mM, internal control upstream and downstream primers 3M, internal control probe 0.3mM. (EGFR Exon 25)

[0040] SEQ ID NO.5:

[0041] Upstream mutant capture primer: 5' tcataccgtcattcatgc ctcacctccaccgtgcarctcatca 3';

[0042] SED ID NO.6:

[0043] Downstream mutant capture primer: 5' gcagctcatgcccttcggctgcctc acgattccacgaccgatg 3';

[0044] SEQ ID NO.4:

[0045] Mutant probe: 5'-tga gct gC a Tga tga gyt-3'; the 8th and 10th bases from the 5' end of the sequence are lock...

Embodiment 2

[0073] Embodiment 2 mutant capture and digital PCR detection

[0074] Materials used:

[0075] 2×EGFR mutant detection solution: 0.2% TritonX-100; 10-20mM MgCl 2 ; 16mM (NH4) 2 SO4; 50mM KCl; 10mM NAD, 40mM Tris-HCl (pH8.0); 0.6M each of the upstream and downstream mutant capture primers, blocking sequence 6M, dTTP 500M, HotTaq enzyme 1.0-3.0U, Ampligase 2.0-5.0U .

[0076] 10x PCR primer and probe solution: PCR upstream and downstream primers 3M each, four dNTPs 5mM each, mutant probe 0.3M, internal control upstream and downstream primers 3M, internal control probe 0.3M. (EGFR Exon 25)

[0077] SEQ ID NO.5:

[0078] Upstream mutant capture primer: 5' tcataccgtcattcatgc ctcacctccaccgtgcarctcatca 3';

[0079] SEQ ID NO.6:

[0080] Downstream mutant capture primer: 5' gcagctcatgcccttcggctgcctc acgattccacgaccgatg 3';

[0081] SEQ ID NO.4:

[0082] Mutant probe: 5'-tga gct gC a Tga tga gyt-3', the 8th and 10th bases from the 5' end of the sequence are locked nucleic aci...

Embodiment 3

[0106] Example three mutant capture and conventional PCR detection

[0107] Materials used:

[0108] 2×EGFR mutant detection solution: 0.2% TritonX-100; 10-20mM MgCl 2 ; 16mM (NH4) 2 SO4; 50mM KCl; 10mM NAD, 40mM Tris-HCl (pH8.0); contains 0.6M upstream and downstream mutant capture primers, blocking sequence 6M, dTTP 500mM, HotTaq enzyme 1.0-3.0U, Ampligase 2.0-5.0U .

[0109] 10x PCR primer solution: 3M each of PCR upstream and downstream primers, 5mM each of the four dNTPs.

[0110] SEQ ID NO.5:

[0111] Upstream mutant capture primer: 5' tcataccgtcattcatgc ctcacctccaccgtgcarctcatca 3';

[0112] SEQ ID NO.6:

[0113] Downstream mutant capture primer: 5' gcagctcatgcccttcggctgcctc acgattccacgaccgatg 3';

[0114] SEQ ID NO.4:

[0115] Mutant probe: 5'-tga gct gCa Tga tga gyt-3', the 8th and 10th bases from the 5' end of the sequence are locked nucleic acid modified bases, and the 9th base from the 5' end is 2 -Aminodeoxyadenylic acid modified base, the 5' end is conne...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for efficiently detecting EGFR T790M mutant, a probe and a kit for detection. According to the invention, the method for EGFR mutant capture primer hybridization, mononucleotide extension and DNA linkage is adopted for recognizing the EGFR T790M mutant in a sample, converting the EGFR T790M mutant into a capture sequence containing a mutation site and adopting the specific probe and PCR amplification specific to the mutation site for detecting the capture sequence with the mutation site, thereby detecting the existence of the EGFR T790M mutant in the sample. The invention also provides the probe and the kit for detecting according to the method; the detection according to the invention has the characteristics of high sensitivity, high specificity and simple operation; the method is suitable for the clinical examination of the trace EGFR T790M mutant in a blood sample of a tumor patient; new method and thought are supplied for personalized cancer therapy.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a method for efficiently measuring epidermal growth factor receptor (EGFR) T790M mutant. Background technique [0002] The epidermal growth factor receptor family (EGFR family) belongs to the tyrosine kinase receptor family, which plays an important role in regulating the proliferation and survival of cancer cells. EGFR is expressed in a variety of tumor cells, and its High expression is usually related to the poor prognosis of tumors. EGFR is therefore used as a target for targeted therapy of solid tumors. The tumor drugs that have been developed to inhibit the tyrosine kinase activity of EGFR include gefitinib (Iressa) and erlotinib (Tarceva ). EGFR is considered to be related to lung cancer. However, tyrosine kinase inhibitor drugs Iressa or Tarceva only have an effect on a small number of patients with non-small cell lung cancer (NSCLC). There is a type of EGFR muta...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6858C12Q1/6886C12Q2600/106C12Q2600/156C12Q2600/166C12Q2525/186C12Q2535/125C12Q2531/113C12Q2561/101
Inventor陈莉莉王焱
OwnerGNOMEGEN