Method for efficiently detecting EGFR T790M mutant, probe and kit for detection
An EGFRT790M, mutant technology, applied in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc., can solve the problem of low ctDNA fragments
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Example 1 Mutant capture and real-time quantitative PCR detection
[0037] Materials used:
[0038] 2×EGFR mutant detection solution: 0.2% TritonX-100; 10-20mM MgCl 2 ; 16mM (NH4) 2 SO4; 50mM KCl; 10mM NAD, 40mM Tris-HCl (pH8.0); 0.6M each of the upstream and downstream mutant capture primers, blocking sequence 6M, dTTP 500M, HotTaq enzyme 1.0-3.0U, Ampligase 2.0-5.0U .
[0039] 10x PCR primer and probe solution: PCR upstream and downstream primers 3M each, four dNTPs 5mM each, mutant probe 0.3mM, internal control upstream and downstream primers 3M, internal control probe 0.3mM. (EGFR Exon 25)
[0040] SEQ ID NO.5:
[0041] Upstream mutant capture primer: 5' tcataccgtcattcatgc ctcacctccaccgtgcarctcatca 3';
[0042] SED ID NO.6:
[0043] Downstream mutant capture primer: 5' gcagctcatgcccttcggctgcctc acgattccacgaccgatg 3';
[0044] SEQ ID NO.4:
[0045] Mutant probe: 5'-tga gct gC a Tga tga gyt-3'; the 8th and 10th bases from the 5' end of the sequence are lock...
Embodiment 2
[0073] Embodiment 2 mutant capture and digital PCR detection
[0074] Materials used:
[0075] 2×EGFR mutant detection solution: 0.2% TritonX-100; 10-20mM MgCl 2 ; 16mM (NH4) 2 SO4; 50mM KCl; 10mM NAD, 40mM Tris-HCl (pH8.0); 0.6M each of the upstream and downstream mutant capture primers, blocking sequence 6M, dTTP 500M, HotTaq enzyme 1.0-3.0U, Ampligase 2.0-5.0U .
[0076] 10x PCR primer and probe solution: PCR upstream and downstream primers 3M each, four dNTPs 5mM each, mutant probe 0.3M, internal control upstream and downstream primers 3M, internal control probe 0.3M. (EGFR Exon 25)
[0077] SEQ ID NO.5:
[0078] Upstream mutant capture primer: 5' tcataccgtcattcatgc ctcacctccaccgtgcarctcatca 3';
[0079] SEQ ID NO.6:
[0080] Downstream mutant capture primer: 5' gcagctcatgcccttcggctgcctc acgattccacgaccgatg 3';
[0081] SEQ ID NO.4:
[0082] Mutant probe: 5'-tga gct gC a Tga tga gyt-3', the 8th and 10th bases from the 5' end of the sequence are locked nucleic aci...
Embodiment 3
[0106] Example three mutant capture and conventional PCR detection
[0107] Materials used:
[0108] 2×EGFR mutant detection solution: 0.2% TritonX-100; 10-20mM MgCl 2 ; 16mM (NH4) 2 SO4; 50mM KCl; 10mM NAD, 40mM Tris-HCl (pH8.0); contains 0.6M upstream and downstream mutant capture primers, blocking sequence 6M, dTTP 500mM, HotTaq enzyme 1.0-3.0U, Ampligase 2.0-5.0U .
[0109] 10x PCR primer solution: 3M each of PCR upstream and downstream primers, 5mM each of the four dNTPs.
[0110] SEQ ID NO.5:
[0111] Upstream mutant capture primer: 5' tcataccgtcattcatgc ctcacctccaccgtgcarctcatca 3';
[0112] SEQ ID NO.6:
[0113] Downstream mutant capture primer: 5' gcagctcatgcccttcggctgcctc acgattccacgaccgatg 3';
[0114] SEQ ID NO.4:
[0115] Mutant probe: 5'-tga gct gCa Tga tga gyt-3', the 8th and 10th bases from the 5' end of the sequence are locked nucleic acid modified bases, and the 9th base from the 5' end is 2 -Aminodeoxyadenylic acid modified base, the 5' end is conne...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com