A kind of myceliophthora thermophila exoglucosidase mutant and its application

A technology of glucosidase and recombinant bacteria, applied in the field of genetic engineering, can solve problems such as difficult to meet industrial production, cellulase activity or low yield, and achieve improved catalytic efficiency, reduced inhibition, and good thermal stability Effect

Inactive Publication Date: 2020-01-03
SHANDONG AGRICULTURAL UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the research on Myceliophthora thermophila, various types of cellulase degrading enzymes have been found, but the activity or yield of these cellulase enzymes is low, and it is difficult to meet the needs of industrial production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of myceliophthora thermophila exoglucosidase mutant and its application
  • A kind of myceliophthora thermophila exoglucosidase mutant and its application
  • A kind of myceliophthora thermophila exoglucosidase mutant and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1: Construction of Exoglucosidase CBH1 of Family VII of Myceliophthora thermophila and Deletion Mutants

[0038] (1) Cloning of cbh1 gene of family 7 exoglucanase of Myceliophthora thermophila

[0039] Inoculate Myceliophthora thermophila (preservation number: CGMCC NO.3.17368) into carboxymethylcellulose induction medium, culture at 50°C for 3 days, scrape mycelia to extract total RNA, and perform reverse transcription to obtain cDNA. Primers were designed according to the nucleotide sequence of exoglucanase CBH1 of the seventh family of Myceliophthora thermophila (GenBank: XM_003660741.1), and EcoR I and Not I restriction sites (underlined) were inserted into the upstream and downstream primers respectively Mark), add 6 histidine (His) tags (dotted line mark) downstream, and design primers as follows:

[0040]cbh1-F:GCTTACGTA GAATTC CAGAACGCCTGCACTCTGAC; (SEQ ID NO. 3)

[0041] cbh1-R:TTAATTC GCGGCCGCATGATGATGATGATGATG CAGGCACTGCG; (SEQ ID NO.4)

[0042...

experiment example 2

[0053] Experimental Example 2: Transformation and Screening of Recombinant Expression Vectors

[0054] The recombinant expression vector and mutant constructed in Example 1 were digested with Pme I, and the digested product was transferred into Pichia pastoris GS115 by electric shock. The electric shock method was an existing conventional method, and the transformed product was placed on MD medium. Cultivate at 28°C, and screen with different concentrations (1-4mg / mL) of G418 after a single spot grows, select a single spot with better growth, and verify it by sequencing with universal primers 3'AOX1 and 5'AOX1.

experiment example 3

[0055] Experimental Example 3: Induced Expression of Recombinant Pichia pastoris Engineering Bacteria and Separation and Purification of Enzyme Protein

[0056] Inoculate Pichia pastoris engineering strains with correctly sequenced wild enzymes and mutated enzymes in BMGY medium, culture at 28°C, 200rpm for 24h, centrifuge at 4000rpm for 5min, collect the bacteria and transfer them to BMMY medium, at 28°C, 200rpm Under methanol induction culture. After induction of expression for 120 hours, centrifuge at 4°C and 8000rpm for 15min to obtain the supernatant, add ammonium sulfate to the supernatant to a saturated concentration, stay at 4°C overnight, centrifuge at 4°C and 8000rpm for 15min to obtain the cells, and use an appropriate amount of PBSA (pH=7.4 ) buffer and purified by HisTrap HP to obtain purified wild enzyme (WT) and mutant enzyme (CBH1-DM). Run SDS-PAGE electrophoresis for the purified wild enzyme and mutant enzyme.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a myceliophthora thermophila exoglucosidase mutant and application thereof. A protein of the invention is named as CBH1-DM and is one of the following proteins (a) and (b): (a)a protein composed of amino acid sequences shown in SEQ ID NO.2 in a sequence table; and (b) a fusion protein obtained by connecting a label at an N terminal or / and C terminal of (a). Compared with awild type, the myceliophthora thermophila exoglucosidase mutant disclosed by the invention has the advantages that enzymatic specific activity is improved by 2.1 times, catalysis efficiency is improved by 8.6 times, and thermal stability is improved by 2 times, so that the myceliophthora thermophila exoglucosidase mutant has a better industrial application prospect.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a mutant of myceliophthora thermophila exoglucosidase and application thereof. Background technique [0002] Cellulose is a linear polymer composed of β-1,4-linked D-glucose units. As the most abundant renewable resource in nature, the degradation of cellulosic biomass plays a decisive role in the global carbon cycle. At present, the use of cellulase to degrade cellulose is an environmentally friendly and efficient method, so increasing the production of cellulase will effectively reduce the production cost of biofuels. Cellulases are classified into the following three types according to their functions: endoglucosidases EGs, exoglucosidases CBHs and β-glucosidases BGLs. With the deepening of research on cellulose degrading enzymes, a series of cellulase enzymes with commercial potential have been discovered. However, in the current commercialized cellulase prepar...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N9/24C12N15/56C12N15/81C12P19/14
CPCC12N9/2402C12N15/815C12P19/14C12Y302/01039
Inventor李多川杨志芹
OwnerSHANDONG AGRICULTURAL UNIVERSITY