Chromium-based functional nucleic acid sensor and application thereof

A functional nucleic acid and sensor technology, applied in genetic engineering, microbial determination/inspection, analysis by chemical reaction of materials, etc., can solve the problems of low reliability and practicability, achieve low cost, high specificity, Effects of high specificity and sensitivity

Active Publication Date: 2018-05-04
CHINA AGRI UNIV
View PDF2 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

This patented technology uses specialized molecules called histone degrading agents that target certain types of metal atoms like iron or copper during their manufacturing process. These chemical substances help remove impurities from metals while still being able to perform various functions such as making them more durable over time. By measuring these properties accurately, researchers have been able to better identify environmental pollution caused by heavy metallization.

Problems solved by technology

Technologies currently exist but there still remains challenged because they require expensive materials like chrome plates, platins, chlorides, sulfur dioxide gas, hydrogen cyanobutrification agents, formaldehydes, nitrochromia, phosphorus pentoxytrisulfonamine, manganes, tetraazacycloheptane, trichlene, trimethylarsone, pentaerythrite, zinc oxidizers, copper powders, iron particles, urances, silica gel, cervices, rubber, reservoir shellfish, seawebies, pesticids, polytungstates, chromite flakes, chromated oils, heavy metals, nickel, caffein, vanadium, selenium, cadmium, tin, tantaluminum, ruthenium, rhodochrome, porphyllites, and similar substances found naturally occurring throughout nature worldwide. These contaminations pose potential hazards threatening humans through their ability to ingest them during consumption. There is a technical problem addressed in this patents where identifying and quantitative analysis techniques capable of accurately measuring minute quantities of chromatochlochrome without causing issues associated with current analyte-based tests.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chromium-based functional nucleic acid sensor and application thereof
  • Chromium-based functional nucleic acid sensor and application thereof
  • Chromium-based functional nucleic acid sensor and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0064] Embodiment 1: The construction method of the sensor based on the functional nucleic acid of chromium

[0065] 1. Experimental materials

[0066] Morpholineethanesulfonic Acid Monohydrate (MES), Potassium Chloride, Sodium Chloride, Magnesium Chloride, Potassium Hydrogen Phosphate, Disodium EDTA, Sulfuric Acid, Tetramethylbenzidine, Hemin, Chromium Chloride, Urea, Nt.BstNBI nick endonuclease, Bst DNA polymerase, etc.

[0067] 2. Sequence design

[0068] Design and synthesize chromium ion DNAzyme substrate chain, DNAzyme enzyme chain and amplification template. In the amplification template, GACTC is the Nt.BstNBI nicking endonuclease recognition sequence, and the first four base pairs of the sequence (between C and A) are the synthetic strand cutting sites. The sequence of TTGGGGGG at the end of the DNAzyme substrate chain is added to increase the Tm value of binding to the amplified template; the chromium ion cutting site is after the rA of the DNAzyme substrate chain...

Embodiment 2

[0088] Embodiment 2: the detection of chromium ion

[0089] The detection of chromium ion concentration, the specific steps are as follows:

[0090] (1) Prepare OD 450 Standard curve with the concentration of chromium ion

[0091] Using the construction method of 3 in Example 1, the chromium ion solutions to be tested are chromium chloride solutions of different concentrations (1M NaCl is the dissolution environment), and the chromium chloride concentrations are 0 μM, 0.01 μM, 0.025 μM, 0.05 μM and 0.08 μM, and prepared OD 450 The standard curve with the concentration of chromium ion ( image 3 ), the standard curve is y=3.5406x+0.0344, R 2 = 0.9823.

[0092](2) in the present embodiment, the chromium ion solution to be measured is a chromium chloride solution (NaCl is a dissolution environment)

[0093] Adopt the construction method of 3 in embodiment 1, microplate reader measures the OD of chromium ion solution to be measured 450 , into the standard curve y=3.5406x+0....

Embodiment 3

[0096] Embodiment 3: A kind of test kit that detects chromium ion

[0097] A kit for detecting chromium ions, comprising a chromium ion deoxyribozyme system, an isothermal amplification system and a display system;

[0098] Chromium ion deoxyribozyme system includes substrate chain, enzyme chain, buffer, chromium ion standard solution and stop solution;

[0099] The isothermal amplification system includes amplification template, dNTPs, ultrapure water, Bst DNA polymerase, polymerase reaction buffer solution, Nt.BstNBI nicking endonuclease and nicking endonuclease reaction buffer solution;

[0100] The display system includes: hemin, enzyme activity buffer, TMB chromogen and 2MH 2 SO 4 .

[0101] The sequence (5'-3') of the DNAzyme substrate chain is: GTCACGAGTCACTATrAGGAAGATGGCGAAATTGGGGGG;

[0102] The sequence (5'-3') of the deoxyribozyme enzyme chain is: CAGTGCTCAGTGATATTGCTCATTTTTGAGCGTGGGTGGAAACTGGATACCGCTTT;

[0103] The sequence (5'-3') of the amplified template i...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a chromium-based functional nucleic acid sensor and an application thereof in the technical field of metal ion detection. The sensor comprises a molecule recognition element, asignal amplification element and a signal conversion element, wherein the molecule recognition element comprises chromium ion deoxyribozyme consisting of a substrate chain and an enzyme chain; the signal amplification element comprises an isothermal amplification system and hemin, and the isothermal amplification system comprises an amplification template; the signal conversion element comprisesa color developing agent. The sensor is based on the chromium ion deoxyribozyme, an isothermal index amplification reaction and a G-quadruplex liquid phase sensing technology, is convenient, quick, high in sensitivity, high in specificity and resistant to high salinity in chromium ion detection and can be used in field detection of chromium ions in the environment.

Description

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
OwnerCHINA AGRI UNIV