Patents
Literature
PatSnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

121 results about "Deoxyribozyme" patented technology

Deoxyribozymes, also called DNA enzymes, DNAzymes, or catalytic DNA, are DNA oligonucleotides that are capable of performing a specific chemical reaction, often but not always catalytic. This is similar to the action of other biological enzymes, such as proteins or ribozymes (enzymes composed of RNA). However, in contrast to the abundance of protein enzymes in biological systems and the discovery of biological ribozymes in the 1980s, there are no known naturally occurring deoxyribozymes. Deoxyribozymes should not be confused with DNA aptamers which are oligonucleotides that selectively bind a target ligand, but do not catalyze a subsequent chemical reaction.

Lead ion detection kit based on constant-temperature cascade nucleic acid amplification and detection method of lead ion detection kit

The invention discloses a lead ion detection kit based on constant-temperature cascade nucleic acid amplification and a detection method of the lead ion detection kit. Lead ions are recognized through deoxyribozyme, strand displacement amplification and a single chain triggered DNA (deoxyribonucleic acid) molecular machine are combined to realize constant-temperature cascade nucleic acid amplification, and the concentration of the lead ions is converted into a remarkably-amplified fluorescence detection signal, thus the concentration of trace lead ions can be precisely measured. Compared with other methods based on deoxyribozyme, the detection method is rapider and higher in sensitivity; and in addition, the requirement for equipment is lower, and the operation is simpler.
Owner:XI AN JIAOTONG UNIV +1

Binary deoxyribozyme probes for nucleic acid analysis

New binary deoxyribozyme or ribozyme probes and methods are described for nucleic acid analysis, which allows the detection of nucleic acids under mild physiologic conditions with extraordinary specificity and high sensitivity to single nucleotide mismatches without PCR amplification.
Owner:THE TRUSTEES OF COLUMBIA UNIV IN THE CITY OF NEW YORK

Functional nucleic acids and methods

The present invention relates to methods of generating amounts of selective nucleic acids. The present invention further relates to selective nucleic acids incorporated within non-coding nucleic acids, capable of binding to or altering a target molecule. Selective nucleic acids may generally refer to, but are not limited to, deoxyribonucleic acids (DNAs), ribonucleic acids (RNAs), artificially modified nucleic acids, combinations or modifications thereof. Selective nucleic acids may also generally refer to, but are not limited to, nucleic acid aptamers, aptazymes, ribozymes, deoxyribozymes, nucleic acid probes, small interfering RNAs (siRNAs), micro RNAs (miRNAs), short hairpin RNAs (shRNAs), antisense nucleic acids, diagnostic probes or probe libraries, aptamer inhibitors, precursors of any of the above and / or combinations or modifications thereof. In one aspect, a method for generating amounts of selective nucleic acids includes incorporating a selective nucleic acid sequence into a carrier nucleic acid. In general, the carrier nucleic acid may be transcribed by a cell into a product nucleic acid which may carry an incorporated selective nucleic acid sequence.
Owner:BIOTEX +1

Isothermal detection method of RNA (Ribonucleic Acid)

InactiveCN103014148AReal-time monitoring of amplification progressAvoid false positive signalsMicrobiological testing/measurementGeneticsDeoxyribozyme
The invention provides a qualitative and quantitive isothermal detection method of RNA (Ribonucleic Acid). The method comprises the steps of after cutting RNA at fixed points by dnazyme (DNAzyme), amplifying RNA through a strand displacement isothermal amplification technique (SDA); and carrying out qualitative or quantitive detection by inspecting a reporter group G-tetramer released from an SDA product. The method can measure trace RNA (comprising mRNA and miRNA) quickly, simply, conveniently, highly sensitively and specifically, and meanwhile, the risk of pollution is reduced.
Owner:CHENGDU INST OF BIOLOGY CHINESE ACAD OF S

Lead ion fluorescent DNA (Deoxyribose Nucleic Acid) probe and fluorescent determination method for lead ion concentration

The invention relates to the field of detection and analysis of lead ion concentration and discloses a lead ion fluorescent DNA (Deoxyribose Nucleic Acid) probe. The lead ion fluorescent DNA probe comprises double strands formed by hybridizing 17E deoxyribozyme with a substrate strand, wherein the tail end of the substrate strand is modified by FAM (Carboxyfluorescein). The invention also discloses a fluorescent determination method for the lead ion concentration by using the probe. The fluorescent detection of the lead ion concentration of a sample to be detected is carried out by taking the lead ion fluorescent DNA probe as an identification element of a lead ion, the FAM for modifying the tail end of the substrate strand as a fluorescent signal molecule and a colloidal gold nanoparticle as a fluorescence quencher according to the fluorescent signal difference generated when the FAM and the lead ion fluorescent DNA probe are subjected to single-double-strand combination. The fluorescent determination method disclosed by the invention has the advantages of high sensitivity, favorable selectivity for the lead ion, low cost, convenience in operation, quickness in detection and the like.
Owner:ELECTROMECHANICAL PRODS DETECTING TECH CENT OF SHANGHAI ENTRY EXIT INSPECTION & QUARANTINE BUREAU

Visual sensor based on functional nucleic acid of cadmium and application thereof

Belonging to the technical field of metal ion detection, the invention discloses a visual sensor based on functional nucleic acid of cadmium and application thereof. The sensor consists of a molecularrecognition component, a signal amplification component and a signal conversion component. The molecular recognition component is composed of cadmium ion deoxyribozyme, which comprises a substrate chain and an enzyme chain. The signal amplification component includes an isothermal amplification system and hemin, and the isothermal amplification system includes an amplification template. The signal conversion component includes a color developing agent. The visual sensor is constructed based on cadmium ion deoxyribozyme, isothermal index amplification reaction and G-quadruplex liquid phase sensing technology, has the advantages of simplicity and rapidity, high sensitivity, high specificity, high salt resistance, low cost and the like, and can be used for field detection of cadmium ions inthe environment.
Owner:CHINA AGRI UNIV

Methods of producing RNAs of defined length and sequence

Methods of making RNA duplexes and single-stranded RNAs of a desired length and sequence based on cleavage of RNA molecules at a defined position, most preferably with the use of deoxyribozymes. Novel deoxyribozymes capable of cleaving RNAs including a leader sequence at a site 3' to the leader sequence are also described.
Owner:ISIS INNOVATION LTD

Constant temperature index amplification technology based on triple amplification reaction connection in series and application of constant temperature index amplification technology in microRNA detection

ActiveCN105018603AHigh sensitivityHighly Selective Fluorescent DetectionMicrobiological testing/measurementFluorescencePolymerase L
The invention discloses a constant temperature index amplification technology based on triple amplification reaction connection in series and an application of the constant temperature index amplification technology in microRNA detection. According to the invention, a special neck ring structure is designed as a medium body, a constant temperature index amplification reaction is triggered, target sequence cycle is fromed under strand displacement reaction effect of polymerase, a lot of short chain DNA fragments are generated through amplification in short time, deoxyribozyme is activated, a fluorescence substrate is cut, target sequence cycle is formed, constant temperature index amplification reaction is carried out, series connection of a triple cycle amplification process of a deoxyribozyme catalytic reaction is carried out, then a rapid constant temperature index amplification technology with high efficiency is established, and the constant temperature index amplification technology can be used for microRNA ultra-sensitive fluorescence detection.
Owner:SUN YAT SEN UNIV

Antisense nucleic acid of resistant and tolerant dimethoxyphenecillin staphylococcus aureus drug resistant gene

The invention relates to antisense oligonucleotides aiming to methicillin-resistant Staphylococcus aureus (MRSA) resistance gene mecR1 / mecA and blaR1 / blaZ and a preparation of the drugs with the antisense oligonucleotides and the application thereof. The antisense oligonucleotides comprise antisense phosphorothiate oligodeoxynucleotide (PS-ODNs) and thiodeoxyribozyme (PS-DRz). The invention is characterized in that the combination of the specificity and the various areas of MRSA resistance gene mecR1 / mecA and blaR1 / blaZ blocks the expression of the resistance gene, the base sequence of the antisense nucleic acid is PS-ODNs01-40, the antisense nucleic acid can combine with the specific site of the target gene, thereby inhibiting the expression of the resistance gene, causing MRSA to restore the sensitivity of the lactam antibiotics and achieving the purpose of effective fighting with the drug resistance of MRSA.
Owner:FOURTH MILITARY MEDICAL UNIVERSITY

Deoxyribozyme hydrogel based copper ion detection sensor

The invention discloses a deoxyribozyme hydrogel based copper ion detection sensor, which is characterized by including deoxyribozyme hydrogel, wherein the deoxyribozyme hydrogel takes the shape of a three-dimensional network which is formed by substrate chains modified by a methacrylic group and the deoxyribozyme hydrogel modified by the methacrylic group through base complementation, pairing and crosslinking; and aurum nanoparticles are coated on the hydrogel. Meanwhile, the invention further discloses a preparation method for the deoxyribozyme hydrogel in the deoxyribozyme hydrogel based copper ion detection sensor, as well as a method for qualitative and semiquantitative detection of the copper ion content in a water sample through the sensor. The invention can realize fast detection of copper ion, requires no expensive complex instruments and devices, has the advantages of high selectivity and high detection speed, and is extremely suitable for onsite detection and laboratory batch sample coarse screening.
Owner:INSPECTION & QUARANTINE TECH CENT OF XIAMEN ENTRY EXIT INSPECTION & QUARANTINE BUREAU

Lncrna serves as a biomarker and therapeutic target

The invention pertains to increased LINC00473 as an indicator of a cancer involving loss or reduction in LKB1 function. LINC00473 is also provided as a therapeutic target for treating a cancer involving loss or reduction in LKB1 function. The invention provides a method of identifying a subject as having a cancer involving loss or reduction in LKB1 function based on the level of LINC00473 in the test sample obtained from the subject and administering an effective amount of a LINC00473 inhibitor to the subject to treat the cancer. The LINC00473 inhibitor can be a small-inhibitory RNA, short hairpin RNA, bifunctional RNA, antisense oligonucleotide, ribozyme, deoxyribozyme, aptamer or small molecule inhibitor. A pharmaceutical composition comprising a LINC00473 inhibitor is also provided for the treatment of a cancer involving loss or reduction in LKB1 function.
Owner:UNIV OF FLORIDA RES FOUNDATION INC

Functional nucleic acid fluorescence sensor with low background and stable temperature and application of sensor in lead ion detection

The invention provides a functional nucleic acid fluorescence sensor with low background and stable temperature. The sensor comprises a molecular recognition component and a signal conversion component, wherein the molecular recognition component is a lead ion dependent deoxyribozyme, which consists of a deoxyribozyme substrate chain and a deoxyribozyme enzyme chain, a nucleotide sequence of the deoxyribozyme substrate chain is shown in SEQ ID NO.1 in a sequence table, and a nucleotide sequence of the deoxyribozyme enzyme chain is shown in SEQ ID NO.2, SEQ ID NO.3 or SEQ ID NO.4 in the sequence table; and the signal conversion component consists of a Sub F whose 5' end is marked by a fluorescent staining group and a Sub Q whose 3' end is marked by a fluorescent quenching group, nucleotidesequences of Sub F and Sub Q are shown in SEQ ID NO. 5 and SEQ ID NO. 6 in the sequence table. The invention further provides an application of the fluorescence sensor in lead ion detection. The fluorescence sensor can improve the sensitivity of the existing biosensor method for detecting lead ions and the tolerance to the detection environment.
Owner:SICHUAN UNIV

High salt tolerant sensor based on functional nucleic acid of zinc and application thereof

Belonging to the technical field of metal detection, the invention discloses a high salt tolerant sensor based on functional nucleic acid of zinc and application thereof. The high salt tolerant sensorcomprises a molecular recognition element, a signal amplification element, and a signal conversion element. The molecular recognition element consists of zinc ion deoxyribozyme, the zinc ion deoxyribozyme consists of a substrate chain and an enzyme chain. The signal amplification element includes an isothermal amplification system and hemin. The isothermal amplification system includes an amplification template. The signal conversion element comprises a color developing agent. The sensor provided by the invention is constructed based on zinc ion deoxyribozyme, isothermal index amplification reaction and G-quadruplex liquid phase sensing technology, can be used for field detection of zinc ions in the environment, and has the advantages of simplicity and rapidity, low cost, high salt tolerance, high sensitivity and good selectivity, and especially can realize visual detection.
Owner:CHINA AGRI UNIV

Single strand nucleic acid detection kit and method as well as application of single strand nucleic acid detection kit and method

The invention belongs to the technical field of molecular detection and particularly relates to a single strand nucleic acid detection kit and method as well as application of the single strand nucleic acid detection kit and method. The shown kit comprises cyclic dnazyme and a molecular beacon; the cyclic dnazyme has a dnazyme sequence. The kit can perform double cycle amplification on a fluorescence signal of the molecular beacon through simple and convenient operation of a one-step method under the assistance of RNase H so as to realize high-sensitivity specific detection on the single strand nucleic acid and is finally applied to detection of the single strand nucleic acid such as viruses or miRNA.
Owner:OCEAN UNIV OF CHINA

High-sensitivity nano composite probe for fluorescent quantitative detection of blood serum tumor marker, composition and fluorescent quantitative kit

ActiveCN108445213AHigh catalytic propertiesRealize integrationMaterial analysisFluorescenceA-DNA
The invention relates to the field of fluorescent quantitative detection and provides a high-sensitivity nano composite probe for the fluorescent quantitative detection of a blood serum tumor marker.The nano composite probe comprises gold nanoparticles loaded with a blood serum tumor marker secondary antibody to be detected and a DNA (Deoxyribonucleic Acid) enzyme chain. The nano composite probeprovided by the invention takes the gold nanoparticles as carriers and a compound formed by loading deoxyribozyme with a high catalytic property keeps the high catalytic property and recognition capability of the deoxyribozyme, and also introduces a signal transduction function of a nano-material, so that recognition and signal transduction functions are integrated. The sensitivity and specificityof the fluorescent quantitative detection are remarkably improved by combining an efficient specific recognition function of the tumor marker, high recognition and catalytic properties of the deoxyribozyme, and signal transduction and fluorescent amplification functions of the gold nanoparticles; the detections sensitivity can reach 0.01ng / mL.
Owner:LINYI UNIVERSITY

Oligonucleotide medicine for treating myophagism

ActiveCN1718194AOrganic active ingredientsMetabolism disorderNucleotideTranslational termination
An oligonucleotide medicine for treating amytrophy contains 7-75 nucleotide, 7-75 adjacent ribosyls, and the 5'-terminate and 3'-terminate non-translation regions and translation start region. Said oligonucleotide includes ribooligonucleotide and deoxyribooligonucleotide. Said oligonucleotide may be antisense oligonucleotide, interfering RNA(RNAi), ribozyme and deoxyribozyme.
Owner:LAKEWOOD AMEDEX

Gold nanoparticle sensor based on pin locking deoxyribozyme probe and application of gold nanoparticle sensor in detecting MUC1

The invention discloses a gold nanoparticle sensor based on a pin locking deoxyribozyme probe and application of the gold nanoparticle sensor in detecting MUC1. The gold nanoparticle sensor comprisesan MUC1 aptamer probe, the pin locking deoxyribozyme probe and gold nanoparticles, wherein the MUC1 aptamer probe can recognize MUC1 and release an aptamer DNA sequence; the pin locking deoxyribozymeprobe sequentially comprises a first connecting sequence, a first binding sequence, a substrate sequence, a second connecting sequence, a deoxyribozyme sequence and a second binding sequence; the first connecting sequence and the second connecting sequence are complementary to enable the pin locking deoxyribozyme probe to form a pin structure; the substrate sequence comprises a cutting site; afterthe first binding sequence, the second binding sequence and the aptamer DNA sequence are complementary, the deoxyribozyme sequence forms an active secondary structure in the catalytic core, and the 5'end of the pin locking deoxyribozyme probe is connected with a fluorophore which can be quenched by the gold nanoparticles; and the 3'end of the pin locking deoxyribozyme probe is connected with goldnanoparticles.
Owner:SHANDONG NORMAL UNIV

High salt tolerant colorimetric sensor based on functional nucleic acid of zinc and application thereof

The invention discloses a high salt tolerant colorimetric sensor based on functional nucleic acid of zinc and application thereof. The high salt tolerant colorimetric sensor includes a molecular recognition element, a signal amplification element, and a signal conversion element. The molecular recognition element consists of zinc ion deoxyribozyme, which is composed of a substrate chain and an enzyme chain. The signal amplification element includes an isothermal amplification system, and the isothermal amplification system also includes an amplification template. The signal conversion elementincludes thioflavin. The molecular recognition element recognizes zinc ions and produces an amplification product, the amplification product forms a G-quadruplex structure under the action of thioflavin, and the fluorescence intensity is detected to calculate the zinc ion concentration. The sensor provided by the invention is based on zinc ion deoxyribozyme, isothermal index amplification reactionand G-quadruplex liquid phase sensing technology, can be used for field detection of zinc ions in the environment, and has the advantages of simple and rapid operation, low cost, high sensitivity andgood selectivity.
Owner:CHINA AGRI UNIV

DNA tetrahedron probe for lead ion detection, and lead ion detection method

The present invention provides a DNA tetrahedron probe for lead ion detection, and a lead ion detection method. The DNA tetrahedron probe comprises a single-stranded probe Tetra-A, a single-stranded probe Tetra-B, a single-stranded probe Tetra-C and a single-stranded probe Tetra-D, wherein the 3' terminal of the single-stranded probe Tetra-A contains a structural domain A, and is complementary to a lead ion-dependent deoxyribozyme probe. According to the present invention, the method has the advantages of simple operation and no requirement of expensive instrument of the DNA tetrahedron probe electrochemical detection method, further has the high specificity of the lead ion-dependent deoxyribozyme probe to lead ions, has the lead ion detection range of 10 pM-1000 nM, has advantages of easy performing and reliable result, and can directly detect tap water or pond water and water from other sources.
Owner:SHANGHAI INST OF MEASUREMENT & TESTING TECH

Method for controlling and improving DNAzyme catalytic activity

The invention relates to a method for controlling and improving G-quadruplex DNAzyme-hemin compound catalytic hydrogen peroxide (H2O2) oxidization2,2minute-Azinobis-(3-ethyl-benzothiazole-6-sulphonate (ABTS) reaction. In the method, the sequence of a known DNAzyme is split to select high-activity nucleic fragments, then two high-activity nucleic fragments are subjected to recombination connection by a multi-thymine (T) nucleotide sequence with a certain length, and the length of the multi-T nucleotide sequence is regulated to control and effectively improve the catalytic activity of the recombined DNAzyme.
Owner:CAPITAL NORMAL UNIVERSITY

Colorimetric sensor for cadmium-based functional nucleic acid and application of colorimetric sensor

The invention discloses a colorimetric sensor for cadmium-based functional nucleic acid and application of the colorimetric sensor in the technical field of metal ion detection. The colorimetric sensor comprises a molecular recognition element, a signal amplification element and a signal conversion element, wherein the molecular recognition element comprises a cadmium ion deoxyribozyme, and the cadmium ion deoxyribozyme comprises a substrate chain and an enzyme chain; the signal amplification element comprises an isothermal amplification system, and the isothermal amplification system comprises an amplification template; the signal conversion element comprises a thioflavin. The colorimetric sensor is based on the cadmium ion deoxyribozyme, equivalent temperature index amplification reaction and the G-quadruplex liquid phase sensing technology, the molecular recognition element recognizes cadmium ions and generates amplification products, and a G-quadruplex structure is formed by the amplification products under the action of thioflavin. The concentration of the cadmium ions is calculated by detecting the fluorescence intensity, and the colorimetric sensor has the advantages of being simple, quick, high in sensitivity, high in specificity, high in salt resistance, low in cost and the like and can be used for on-site detection of the cadmium ions in the environment.
Owner:CHINA AGRI UNIV

Deoxyzyme of anti-respiratory syncytial viruses and its medicinal use

A deoxyribonse of anti-respiratory tract syncytium virus and its medicinal use are disclosed. The deoxyribonse has purine in RSV RNA nucleotide sequence; pyramine site cracks RNA catalytic active domain specially, the No.1 combined domain adjacent to catalytic domain 5' end is supplemented combined with base sequence specificity at one side of RSV RNA incision site; the No.2 combined domain adjacent to catalytic domain 3' end is supplemented combined with base sequence specificity at one side of RSV RNA incision site. It contains 0.01mg-20mg / 50 mu l anti-respiratory tract syncytium virus deoxyribonse solution. It is non-toxic, has better medicine sensitivity and can inhibit respiratory tract syncytium virus duplication specially.
Owner:CHILDRENS HOSPITAL OF CHONGQING MEDICAL UNIV

10-23 desoxyribonuclease of bacillus resisting tubercle branch

InactiveCN1597941ABypassing barriers to drug resistanceAddressing the problem of elusive latent tuberculosis infectionAntibacterial agentsPeptide/protein ingredientsFatty acidMycobacterium
The invention provides four 10-23 deoxyribozymes that have anti-mycobacterium tuberculosis activity: SEQ IDNO:1, SEQ IDNO:2, SEQ IDNO:3 and SEQ IDNO:4, and as acting on different parts of mycobacterium tuberculosis iclmRNA, they can all cut off the iclmRNA, peculiarly to inhibit the expression of the mycobacterium tuberculosis icl gene and make the mycobacterium tuberculosis in a latent infection state unable to use fatty acid as carbon source, thus killing the mycobacterium tuberculosis in the latent state. For this, the invention provides the use of the above-mentioned deoxyribozymes in preparing curative medicines to cure tuberculosis, especially latent infection of tuberculosis.
Owner:朱道银 +1

Method for detecting miRNA-21 by blood glucose meter based on dnazyme and sucrase

The invention discloses a method for detecting miRNA-21 by a blood glucose meter based on dnazyme and sucrase. The method comprises the following steps: coupling a substrate chain and a dnazyme chain silenced by a sway chain on a magnetic bead, allowing target miRNA to be hybridized and combined with the sway chain after the target miRNA appears, and separating from the dnazyme chain so as to activate the dnazyme to cut the substrate chain; and allowing the released sucrase to hydrolyze sucrose to glucose, and acquiring the output signal by the detection of a blood glucose meter. According to the method, the detection signal of the miRNA is subjected to double enzyme amplification by introducing the dnazyme and the sucrase, so that the detection sensitivity is improved, a linear relation exists in the range of 100-1000fM, the detection limit is 68.08fM, and the method has the advantages of simplicity, convenience, rapidness, sensitivity, high efficiency, low cost and the like.
Owner:CHINA PHARM UNIV

Dnazyme-nanoparticle conjugates and methods of use thereof

The present invention relates to DNAzymes (also known as deoxyribozymes, DNA enzymes, catalytic DNA, or DZ), which are conjugated to nanoparticles (NP) to facilitate the detection of nucleic acids. One aspect of the invention relates to compounds comprising DNAzymes conjugated to nanoparticles (DZ-NP), such as metallic or gold nanoparticles, and methods for their synthesis. Another aspect of the invention relates to methods of using the conjugated compounds to detect nucleic acids, such as genomic material or transcripts of infectious agents, such as viruses, exemplified by applications demonstrating visual detection of Flavivirus RNA molecules, such as dengue virus, or Alphavirus RNA molecules, such as chikungunya virus, in short time periods, using compositions comprising stable components.
Owner:UNIV OF NOTRE DAME DU LAC

Thrombin detection method based on magnetic separation of deoxyribozyme and circular cutting and thrombin kit

The invention discloses a thrombin detection method based on magnetic separation of deoxyribozyme and cyclic cleavage and a thrombin kit, and the thrombin detection method comprises the following steps: adding magnetic beads into a coupling buffer solution, uniformly mixing, centrifugally separating the supernatant, washing, adding a coupling buffer solution and a DNA stock solution of thrombin modified with biotin, centrifugally separating a supernatant, and washing with an incubation buffer solution for 2-3 times to obtain a magnetic bead dispersion liquid, wherein the magnetic bead concentration in the magnetic bead dispersion liquid is 4-6mg / mL; uniformly mixing the magnetic bead dispersion liquid, thrombin, a thrombin aptamer modified with deoxyribozyme and an incubation buffer solution, separating a supernatant, washing the supernatant, and dissolving the obtained solid in an enzyme digestion buffer solution to obtain a mixed solution; and adding the mixed solution into an enzyme digestion buffer solution containing a substrate chain, oscillating and incubating for 2.5-3.5 hours, carrying out magnetic separation, taking supernate, carrying out fluorescence detection, and judging the content of thrombin according to the detected fluorescence intensity. The anti-interference capability is strong, and the sensitivity is high.
Owner:WEST CHINA HOSPITAL SICHUAN UNIV

Deoxyribozyme probe for detecting staphylococcus aureus as well as application thereof

The invention discloses a deoxyribozyme probe for detecting staphylococcus aureus as well as application thereof. The structure of the deoxyribozyme probe for detecting staphylococcus aureus, which isprovided by the invention, is as follows: ACTCTTCCTAGCFRQGGTTCGATCAAGACACGGATCCTGACAAGGGCCAAGTTAGAATTCTAGCGTAGGGAGAGTCTCCGCCTGCAGCTCCGTCCG, wherein F is T base modified by a fluorescence group; Q isT base modified by a quenching group; and R represents singly inserted RNA base A. An experiment proves that the probe can perform rapid, accurate and high-sensitivity detection on the staphylococcusaureus.
Owner:SHENZHEN GRADUATE SCHOOL TSINGHUA UNIV