68 results about "Colorimetric sensor" patented technology

The invention belongs to the technical field of food safety detection, and discloses a preparation method of an aptamer colorimetric sensor constructed by amorphous cobalt-based nano-enzyme and detection application of the aptamer colorimetric sensor to zearalenone (ZEN) in food, and the preparation method comprises the following steps: constructing amorphous Co3O4 (at) CN / SiO2 nano-enzyme; and constructing an aptamer (Apt) colorimetric sensor to detect the ZEN. The amorphous Co-based nano material is simple in preparation process, high in catalase-like activity, easy to modify by biological materials and low in cost. The colorimetric sensor for detection is based on Co3O4 (at) CN / SiO2 nano-enzyme adsorption aptamers, the construction process is simple, the used aptamers are TCATCTATGGTACATACTATCTGTAATGTGATATG and are marked as ZEN-Apt, a detection system of the colorimetric sensor is characterized in that Co3O4 (at) CN / SiO2, ZEN-Apt and ZEN with different concentrations are incubated at a proper temperature to form a competitive reaction, and ZEN-Apt and ZEN are preferentially combined, so that the aptamers on the nano-enzyme are reduced. When the sensor constructed by the invention is used for detecting and analyzing unknown ZEN in an actual sample, the operation is convenient, the specificity is good, the sensitivity is high, the speed is high, and the repeatability and the reproducibility are good.

The invention discloses a method for detecting glucose on the basis of cascade catalysis of cerium dioxide / gold nano cluster-Prussian blue nano enzyme (AuNCs-CeO-HMPB). The material is prepared by compounding cerium dioxide (CeO) with similar glucose oxidase activity and hollow Prussian blue nanoparticles (AuNCs-HMPB) modified by gold nanoclusters with similar peroxidase activity through a hydrothermal assembly method. In the presence of glucose, CeO catalyzes oxidation of glucose to generate gluconic acid and H2O2, then AuNCs-HMPB synergistically catalyzes decomposition of newly generated H2O2 to generate high active oxygen species, further a colorless 3, 3 ', 5, 5'-tetramethyl benzidine (TMB) color developing agent is oxidized to generate obvious color change, and based on the cascade catalytic reaction, the enzyme-free glucose colorimetric sensor is successfully constructed. The sensor shows excellent detection performance on glucose under optimized conditions (pH = 4.0, 50 DEG C), the linear detection range is 10.00-90.00 [mu] mol / L, and the detection limit is 2.1 [mu] mol / L (S / N = 3).

The invention relates to a non-toxic luminescence-based colorimetric sensor and methods of using the sensor in food contact and similar applications. The luminescence-based sensor can be used to assess oxygen concentration, particularly in controlled oxygen atmospheres such as food packaging.

1. Name of the product in this design: Colorimetric sensor. 2. Purpose of this design: As a colorimetric sensor. 3. The key design feature of this product is its shape. 4. The image or photograph that best illustrates the design's key features: the front view.

The invention discloses an ammonia colorimetric sensor for detecting meat freshness. According to the sensor, cellulose aerogel is used as a sensing base material, the natural pigment hematoxylin is used as an indicator, and the natural pigment loaded bio-based ammonia colorimetric sensor is constructed by utilizing the characteristics of high porosity and large specific surface area of the cellulose aerogel and the characteristic that the hematoxylin is sensitive to the change of a pH value. And when the freshness of meat is reduced, ammonia gas and other substances can be released, so that the pH value of the environment is changed, and the color of the hematoxylin is changed, so that the putrefaction degree of food can be intuitively reflected. In order to improve the practicability of the sensor in a complex environment, methyl trimethoxy silane is used for carrying out hydrophobic modification treatment on the surface of the cellulose aerogel, and the treatment can effectively inhibit the interference of moisture on the cellulose aerogel. The invention provides a convenient, sensitive, rapid and efficient solution for detecting the freshness of the food.

The present application relates to a kind of metal-organic framework mediated multi-enzyme nanoparticles and its application, especially the method for alpha-amylase detection. By detecting product absorbance, the quantitative detection of alpha-amylase activity is realized. According to the nature of MFM analog enzyme and its ability as natural enzyme carrier, Agl@MFM@Gox@MFM is prepared, compared with natural enzyme, the composite material has strong resistance, can successfully protect the activity of enzyme. Based on the cascade catalytic system of multi-enzyme nanoparticles Agl@MFM@Gox@MFM, a biosensor is first synthesized and established for detecting alpha-amylase, successfully combines chemical catalyst with natural enzyme, has wide detection linear range (5-500 U / L) while has excellent specificity to alpha-amylase. Benefited from the advantages of low cost, easy preparation and excellent stability, the colorimetric sensor has been successfully used to determine the activity of alpha-amylase in koji.

The invention relates to the technical field of harmful substance detection, in particular to a three-channel colorimetric sensor for simultaneously detecting aflatoxin and a precursor thereof as well as a preparation method and application of the three-channel colorimetric sensor. According to the method, COFFe / NiP-Ph is utilized for catalyzing 3, 3 ', 5, 5'-tetramethylbenzidine (TMB) to be oxidized to generate blue oxTMB, o-phenylenediamine (OPD) is utilized for generating yellow oxOPD, and then the aflatoxin and the precursor thereof are detected through a three-channel colorimetric sensor. Purple ox4-AT is generated by using a mixture of N-ethyl-N-(3-sulfopropyl)-3-methylaniline sodium and 4-aminoantipyrine (4-AT), so that the colorimetric response is realized in a short time. The preparation method of the COFFe / NiP-Ph nano enzyme comprises the following steps: 1, a synthesis process of Fe-TAPP; 2, synthesis of Ni-TAPP is carried out; and 3, synthesizing the iron / nickel porphyrin covalent organic framework. The colorimetric sensor can be prepared into a detection reagent or a kit so as to realize qualitative and quantitative detection of aflatoxin and a precursor thereof in a sample to be detected. The detection method is simple and convenient to operate, and complex pretreatment on a to-be-detected sample is not needed; the detection cost is low, the detection is quick, and the requirement on a detection instrument is low.

This invention introduces an advanced odor detection and classification system that integrates optical and conductive sensors with artificial intelligence for precise, real-time identification of odor profiles across diverse fields. The system employs a colorimetric sensor to capture CIELAB values and a conductive sensor to measure voltage, with data processed through a Neural Network model. This model is trained on an extensive dataset to recognize and predict odors, adapting to variations in odor intensity for enhanced accuracy. Designed for high selectivity, stability, and resilience to environmental factors, the system is ideal for applications in medical diagnostics, food quality control, environmental monitoring, and industrial safety.

This invention discloses a method for preparing amorphous Cu-MOFs and their applications, relating to the field of metal-organic framework materials technology. The key technical points are: CuCl2 is used as the copper source and 4,4′-bipyridine as the ligand, and Cu-MOFs are synthesized via a solvothermal method. Transmission electron microscopy shows that the obtained material exhibits a typical micron-scale sheet-like morphology. After etching with ammonia, the sample morphology transforms into rough-surfaced nanospheres with a significantly increased pore size, indicating a local rearrangement of its framework structure. X-ray diffraction analysis shows that the original Cu-MOF has high crystallinity, while the diffraction peaks of the etched aCu-MOF essentially disappear, exhibiting amorphous characteristics. As a signal conversion element in a colorimetric sensor, aCu-MOF can achieve reliable detection of ampicillin under neutral conditions. Using thiram as a cofactor, a highly selective thiram colorimetric sensing system can be constructed.

The present application relates to the field of nanomaterials and analytical detection technology, in particular to a reagent for rapid detection of aureomycin and a rapid detection method of aureomycin. After adding 3-mercaptopropionic acid modified AgInS2 quantum dots to aureomycin, the fluorescence intensity and color of AgInS2 QDs change due to electrostatic interaction and band gap transition, thereby constructing a fluorescence colorimetric sensor to realize the ultra-sensitive detection of aureomycin. In order to realize the on-site detection of aureomycin, a portable device equipped with a smartphone and integrated with the AgInS2 QDs sensor is also designed. The cloud server data analysis system based on machine learning algorithm is integrated into the smartphone, which is convenient for color data collection, correction, interpretation and display. The present application utilizes the function of modern smartphones to capture and process fluorescence color signals, thereby providing a user-friendly on-site detection solution for aureomycin detection.

The application discloses a heavy atom enhanced calix cyanine dye radioactivity detection colorimetric sensor, the dye is prepared by introducing heavy atoms in the calix cyanine dye skeleton, and the radiation sensitivity is significantly improved; the dye reacts with hydroxyl radicals generated by water radiolysis under the action of radiation, conjugate structure is destroyed, and color change from green to yellow is generated; the application comprises a colorimetric test strip prepared from the dye, and a detection system integrated with a smartphone image recognition function, the test strip comprises a base material and an additive; the additive comprises a copolymer, and preparation reaction monomers of the copolymer comprise N,N-diethylaminoethyl acrylate and 3-methylpent-2-ene dimethyl acid; the application has the advantages of high sensitivity, low cost, simple operation, portability and the like, can be used for rapid, visual and quantitative detection of radionuclides in water solution, urine and the like samples, and has important application value in the field of nuclear medicine radiation safety monitoring.

This invention relates to the field of tetracycline detection technology, specifically disclosing an iron porphyrin hydrogen-bonded organic framework nanozyme, its preparation method, and its applications. The iron porphyrin hydrogen-bonded organic framework nanozyme comprises an iron porphyrin hydrogen-bonded organic framework, gold nanoparticles, and a tetracycline nucleic acid aptamer. The gold nanoparticles are non-covalently loaded onto the surface and pores of the iron porphyrin hydrogen-bonded organic framework, and the tetracycline nucleic acid aptamer and gold nanoparticles are connected by coordination covalent bonds. The iron porphyrin hydrogen-bonded organic framework nanozyme exhibits peroxide-like nanozyme activity, catalyzing the oxidation of the chromogenic substrate TMB in the presence of H₂O₂ to detect tetracycline content. By introducing the hydrogen-bonded organic framework and the tetracycline nucleic acid aptamer, the detection specificity is improved, achieving highly sensitive, highly selective, and rapid detection of tetracycline. The colorimetric sensor constructed based on the iron porphyrin hydrogen-bonded organic framework nanozyme provides a new method for rapid and visual detection of tetracycline in feed.

The present invention relates to a luminescence-based colorimetric sensor and to methods of use thereof. The sensor can be used to assess oxygen concentration, in particular in controlled oxygen atmospheres such as food packaging. In embodiments, the invention also relates to thin-film oxygen sensors, in particular for food packaging applications.

The invention discloses a DNA framework nucleic acid cascade enzyme, a paper-based colorimetric sensor and a preparation method and application of the paper-based colorimetric sensor, and belongs to the technical field of biological detection.The DNA framework nucleic acid cascade enzyme comprises a first enzyme, a second enzyme, a first DNA tetrahedron and a second DNA tetrahedron; the first enzyme is glucose oxidase with the surface modified by DBCO-pri, and the second enzyme is horse radish peroxidase with the surface modified by DBCO-pri; the first enzyme and the first DNA tetrahedron as well as the second enzyme and the second DNA tetrahedron are respectively connected through base complementary pairing; the first DNA tetrahedron and the second DNA tetrahedron are hybridized through a nucleic acid connecting chain to form a dimer structure. According to the invention, the DNA nanostructure is used for accurately fixing enzyme molecules and controlling the spatial arrangement of the enzyme molecules, the cascade catalytic efficiency is improved, and the advantages of low cost and portability of a paper-based platform are combined, so that high-sensitivity, rapid and visual detection of sweat glucose is realized.

An apparatus having: a container, a first openable vessel within the container, an analyte within the first vessel, and a vapochromic sensor within the container. The vapochromic sensor changes color on contact with a vapor of the analyte.

The invention discloses a V2C / CeO2 compound and a preparation method and application thereof.Ce (NO3) 3, NaOH and V2C serve as raw materials, vanadium carbide and cerium oxide (V2C / CeO2) is synthesized through a hydrothermal method, the crystal face of CeO2 is changed through V2C, the morphology of CeO2 is changed, the electron transmission capacity is improved, then the oxidase-like activity is improved, the high oxidase-like activity and stability are achieved, and the V2C / CeO2 compound can be used for preparing a composite material with the high oxidase-like activity and stability. The problems of low catalytic activity and poor selectivity of cerium oxide in ascorbic acid detection are solved. A colorimetric sensor for ascorbic acid detection can be manufactured based on the V2C / CeO2 compound, and the compound has the advantages of being low in cost, high in stability and easy to store.

The present invention relates to a breather for a transformer and, more particularly, to a breather for a transformer, in which a colorimetric sensor, which changes color in response to moisture, is mounted inside the breather that regulates internal pressure of the transformer and removes moisture generated therein, such that a replacement timing of the breather can be easily identified from the outside on the basis of whether a color change has occurred, and a check valve is installed inside the breather to automatically discharge and reduce internal pressure of the transformer when the pressure rises, and to automatically reset when the pressure falls below a predetermined level, thereby blocking the inflow of external air.

This invention discloses a molecularly imprinted paper-based microfluidic colorimetric sensor for detecting histamine, its preparation, and its application. The colorimetric sensor (MIP@MIL) is polymerized from a metal-organic framework (MIL-101) using surface molecular imprinting and dual-monomer imprinting techniques. MIP@MIL exhibits a histamine detection limit of 0.77 μM and a detection time of 12.5 min, demonstrating good selectivity. The mechanism involves histamine blocking the imprinted pores of MIP@MIL and acting on MIL-101, thereby weakening the catalytic oxidation process of the chromogenic agent 2,2'-azido-bis-3-ethylbenzothiazoline-6-sulfonic acid (ABTS). Furthermore, histamine increases the repulsive force of MIP@MIL against ABTS, thus enabling colorimetric detection of histamine. To further improve practical applicability, MIP@MIL was loaded onto qualitative filter paper and further modified onto microfluidic paper-based chips (μPADs). Using a smartphone, rapid and accurate visual detection of histamine in food was achieved, demonstrating its potential for food freshness detection.

A method for preparing an ultraviolet (UV)-degradable and functionalized cellulose paper-based colorimetric sensor, in which a TiO2-loaded cellulose filter paper is prepared, from which a TiO2 / OTS-loaded functionalized cellulose filter paper is prepared; and the TiO2 / OTS-loaded functionalized cellulose filter paper is combined with colorimetric materials to obtain the UV-degradable and functionalized cellulose paper-based colorimetric sensor with multiple hydrophilic dye-loading regions and a hydrophobic isolation region. This application further provides a food quality evaluation method, in which a food quality evaluation model is established based on the UV-degradable and functionalized cellulose paper-based colorimetric sensor.

The invention discloses a hydrogel-based colorimetric sensor and device for detecting sterigmatocystin and application, and belongs to the technical field of harmful substance detection. The hydrogel-based colorimetric sensor disclosed by the invention comprises an Au (at) Cu2O nano enzyme, a nucleic acid aptamer of sterigmatocystin, COOH-cDNA1, COOH-cDNA2 and an ionic liquid hydrogel; the hydrogel-based colorimetric sensor can specifically recognize ST, the detection method is simple and convenient to operate, and a sample to be detected does not need to be subjected to complex pretreatment; the detection cost is low, the detection is quick, and the requirement on a detection instrument is low. The kit is matched with a portable colorimetric device to realize on-site rapid detection of ST, a detection result is obtained by collecting R, G and B values of a detected solution through a smart phone, calculating a Blue / Green ratio and substituting the Blue / Green ratio into a standard curve. Therefore, the method has a wide application prospect in sterigmatocystin detection.

The application discloses a MOFs-based nanoscale enzyme activated persulfate PFASs colorimetric sensor construction method and application, and two MOFs-based nanoscale enzymes including PCN-222(Fe) powder precursors and modified PCN-222(Fe)-3F powder are prepared in sequence. The PCN-222(Fe)-3F with enzyme-like activity activates persulfate to catalyze TMB to present blue color. When PFOS exists, the catalytic activity of PCN-222(Fe)-3F is inhibited, thereby inhibiting the color development process. A rapid visual detection system of PFOS is established according to the linear relationship between the absorbance attenuation and the PFOS concentration. The method is low in cost, simple in operation, reasonable and efficient, high in sensitivity, and has a lower detection limit, and fills the blank of the colorimetric sensor technology in the prior art for rapidly detecting and screening PFASs in environmental media.

The invention discloses a copper amino acid nano-enzyme colorimetric sensor, a preparation method thereof and application of the copper amino acid nano-enzyme colorimetric sensor in stored tea quality discrimination and catechin detection, and belongs to the technical field of nano-enzyme and biological substance analysis and detection. The preparation method of the copper amino acid nano-enzyme comprises the following steps: uniformly mixing a Cu < 2 + > solution, NaOH and amino acid to obtain the copper amino acid nano-enzyme, the volume ratio of the Cu < 2 + > solution to the NaOH to the amino acid is (8-15): (3-7): (3-7); the concentrations of the Cu < 2 + > solution, the NaOH and the amino acid are all 1-3 mmol / L. The sensor has the beneficial effects that the sensor of the ketoamino acid nano-enzyme can qualitatively monitor the freshness of green tea Enshi haworthia cooperi in the storage process and quantitatively monitor catechin contained in the green tea Enshi haworthia cooperi, and a new choice is provided for quality evaluation and control of Enshi haworthia cooperi storage.

The invention provides an aptamer colorimetric sensor for detecting tetracycline as well as a preparation method and application of the aptamer colorimetric sensor, the aptamer colorimetric sensor comprises a mixture of Au (at) Ce MOF and an aptamer or Au (at) Ce MOF-Apt, and the Au (at) Ce MOF-Apt is obtained by mixing and incubating the activated aptamer and the Au (at) Ce MOF. According to the aptamer colorimetric sensor disclosed by the invention, Au-coated Ce MOF with high oxidase-like activity is synthesized by loading gold nanoparticles onto Ce MOF, and then the colorimetric aptamer sensor with enhanced anti-interference capability, higher sensitivity and lower detection limit (8.42 nM) is constructed by fixing an aptamer on the surface of Au-coated Ce MOF based on the principle that TC and Au-coated Ce MOF interact to reduce the oxidase-like activity of Au-coated Ce MOF.

The invention discloses a colorimetric sensing composite yarn capable of detecting acid-base gas and a preparation method of the colorimetric sensing composite yarn, and relates to the technical field of spinning. Waste animal protein textiles are recycled and ground into micro powder, surface functional groups and adsorption sites of the micro powder are increased, and the gas adsorption capacity of the micro powder is improved; the preparation method comprises the following steps: firstly, preparing micro-powder and an indicator into slurry, spraying the slurry onto a non-woven fabric strip, combining the micro-powder and the strip into a composite yarn through a particle flow spinning technology, and finally, coating the surface of the yarn with protein nanofibers by utilizing an electrostatic spinning technology to prepare the colorimetric sensing composite yarn. The yarn has rich hollow gaps and nano structures, gas molecules are enriched in the yarn body through mass transfer and adsorption, the yarn has excellent colorimetric sensing sensitivity and short color development time, and meanwhile, the yarn-based colorimetric sensor has the characteristics of wear resistance, water washing resistance, flexibility, comfort and knittability, and can be applied to the field of colorimetric sensors. And the composite material is an ideal carrier which is integrated with various functional materials and is used as flexible wearable monitoring equipment.

The application belongs to the field of electrochemistry, and relates to tumor protein P53 gene detection, in particular to a label-free double-color test strip, a kit and a preparation method thereof for tumor protein P53 gene detection. The application belongs to a novel LFA method, which combines DNA hybridization chain reaction with the electrostatic adsorption principle of test line / control line, selects common and cost-effective bovine serum albumin as the test line, utilizes the difference in the adsorption capacity of BSA to double-stranded DNA and nano-gold, and the different flow rates of different molecules on the NC membrane to complete the detection of p53 at different concentrations. The test line is constructed by positively charged PDDA to ensure the effectiveness of the LFA. Meanwhile, the detection principle of a liquid colorimetric sensor is combined, and the double-color development greatly reduces the detection limit of the test strip. The sensor is label-free throughout, and has high analytical performance in terms of sensitivity, selectivity and practicability. The p53 gene is detected on the lateral flow test strip for the first time.

The invention provides a FeCoP-NC diatomic nano enzyme as well as a preparation method and application thereof. The used FeCoP-NC nano-enzyme has active sites of FeN3P-CoN3P, the mass fraction of doped P is 0.08%-0.12%, the mass fraction of Fe is 0.25%-0.32%, the mass fraction of Co is 0.5%-0.58%, the FeCoP-NC nano-enzyme is of a dodecahedron structure, the surface area of the FeCoP-NC nano-enzyme is 810-830 m < 2 > / g, the FeCoP-NC nano-enzyme is of a porous structure, and the pore diameter of the FeCoP-NC nano-enzyme is 3-3.5 nm. The FeCoP-NC nano-enzyme disclosed by the invention has excellent oxide-like enzyme activity, and can be used as a catalyst for catalyzing a chromogenic reaction of a chromogenic substrate in a colorimetric sensor.

This invention discloses a reversible responsive MOF-confined colorimetric sensor patch and its preparation method, belonging to the field of aerogel-based colorimetric sensing technology. The sensor patch is composed of agarose, polyethylene glycol, and a UiO-66 / methyl red composite aerogel. Methyl red is anchored within the MOF through the nanopore confinement effect of UiO-66 and the coordination of zirconium cluster sites, forming UiO-66 / methyl red composite nanoparticles, which are interleaved within the porous network structure layers formed by hydrogen bonding cross-linking of agarose and polyethylene glycol. The preparation method includes: hydrothermal synthesis of UiO-66 / methyl red composite nanoparticles, mixing with polyethylene glycol, adding agarose to dissolve, and freeze-drying to form the final product. This patch exhibits properties such as resistance to dye leakage, resistance to temperature interference, reversible response, wide pH response, and rapid response, and can be used for pH detection in scenarios such as body fluids, environmental water samples, bacterial cultures, and wounds.

The invention discloses a molecular imprinting colorimetric sensor for detecting hepatitis B virus as well as a preparation method and application of the molecular imprinting colorimetric sensor. The sensor takes an aminated zeolite imidazate framework material (ZIF-8-NH2) with peroxidase-like activity as a catalytic core, after surface double-bond functionalization, a molecularly imprinted polymer (MIPs) layer is constructed on the surface through a free radical polymerization reaction by taking the aminated zeolite imidazate framework material as a carrier and taking HBV as a template molecule. According to the sensor, after HBV is specifically recognized and captured through MIPs, the catalytic efficiency of ZIF-8 on hydrogen peroxide is changed, then the generation amount of hydroxyl radicals is regulated and controlled, and finally visual and quantitative detection of HBV is achieved through the color fading reaction of the hydroxyl radicals and chromogenic dye crystal violet. The sensor prepared by the invention has the advantages of high sensitivity, strong specificity, low cost, simplicity and convenience in operation, rapidness in detection and the like, and can be used for rapid screening and on-site instant detection of hepatitis B viruses.