102 results about "Colorimetric sensor" patented technology

The invention discloses a fluorescent colorimetric sensor for detecting circulating tumor cells and a preparation method of the fluorescent colorimetric sensor. The preparation method comprises the following steps: S4, adding a prepared detection antibody modified with horse radish peroxidase and used for detecting the circulating tumor cells, and incubating; s5, adding a Tris buffer solution and a H2O2 solution, and incubating; s6, preparing an EuMOF nanoflower solution; and S7, adding the EuMOF nanoflower solution and 3, 3 ', 5, 5'-tetramethyl benzidine to react, detecting the fluorescence intensity in the presence of circulating tumor cells with different concentrations by using a luminoscope, detecting the ultraviolet absorbance value in the presence of circulating tumor cells with different concentrations by using a multifunctional microplate reader, and constructing a fluorescence intensity-concentration working curve and an ultraviolet absorbance value-concentration working curve. The method is used for qualitative and quantitative analysis and detection of the circulating tumor cells, realizes bimodal signal response to the circulating tumor cells, and has high sensitivity and simplicity and convenience in operation.

The invention belongs to the technical field of food safety detection, and discloses a preparation method of an aptamer colorimetric sensor constructed by amorphous cobalt-based nano-enzyme and detection application of the aptamer colorimetric sensor to zearalenone (ZEN) in food, and the preparation method comprises the following steps: constructing amorphous Co3O4 (at) CN / SiO2 nano-enzyme; and constructing an aptamer (Apt) colorimetric sensor to detect the ZEN. The amorphous Co-based nano material is simple in preparation process, high in catalase-like activity, easy to modify by biological materials and low in cost. The colorimetric sensor for detection is based on Co3O4 (at) CN / SiO2 nano-enzyme adsorption aptamers, the construction process is simple, the used aptamers are TCATCTATGGTACATACTATCTGTAATGTGATATG and are marked as ZEN-Apt, a detection system of the colorimetric sensor is characterized in that Co3O4 (at) CN / SiO2, ZEN-Apt and ZEN with different concentrations are incubated at a proper temperature to form a competitive reaction, and ZEN-Apt and ZEN are preferentially combined, so that the aptamers on the nano-enzyme are reduced. When the sensor constructed by the invention is used for detecting and analyzing unknown ZEN in an actual sample, the operation is convenient, the specificity is good, the sensitivity is high, the speed is high, and the repeatability and the reproducibility are good.

The invention discloses a method for detecting glucose on the basis of cascade catalysis of cerium dioxide / gold nano cluster-Prussian blue nano enzyme (AuNCs-CeO-HMPB). The material is prepared by compounding cerium dioxide (CeO) with similar glucose oxidase activity and hollow Prussian blue nanoparticles (AuNCs-HMPB) modified by gold nanoclusters with similar peroxidase activity through a hydrothermal assembly method. In the presence of glucose, CeO catalyzes oxidation of glucose to generate gluconic acid and H2O2, then AuNCs-HMPB synergistically catalyzes decomposition of newly generated H2O2 to generate high active oxygen species, further a colorless 3, 3 ', 5, 5'-tetramethyl benzidine (TMB) color developing agent is oxidized to generate obvious color change, and based on the cascade catalytic reaction, the enzyme-free glucose colorimetric sensor is successfully constructed. The sensor shows excellent detection performance on glucose under optimized conditions (pH = 4.0, 50 DEG C), the linear detection range is 10.00-90.00 [mu] mol / L, and the detection limit is 2.1 [mu] mol / L (S / N = 3).

This invention discloses a biological tissue stiffness measurement device and its usage method. The device includes a stage for placing biological tissue slices, a Z-axis displacement stage, a photonic crystal colorimetric sensor, a light source, an imaging device, and a host computer. The light source illuminates the photonic crystal colorimetric sensor. The Z-axis displacement stage causes the biological tissue slice to press down on the photonic crystal colorimetric sensor, causing its color to change. The imaging device receives the color information from the photonic crystal colorimetric sensor and sends it to the host computer. When applied to biological tissue stiffness imaging, this device controls the tissue slice to descend at required step distances, causing the tissue slice to be vertically pressed against the photonic crystal colorimetric sensor. By recording and imaging the color of the photonic crystal colorimetric sensor and calculating the stiffness information, the device minimizes damage to the biological tissue being tested.

The invention provides an ascorbic acid high-sensitivity colorimetric sensor as well as a preparation method and application thereof, and aims to solve the problem of low sensitivity of an MOFs (Metal-Organic Frameworks) nano material in ascorbic acid detection. Ce-UiO-66-NH2 nano enzyme particles can catalyze O2 to oxidize TMB (Tetramethylbenzidine) to generate a blue product (TMBOX) under an acidic condition; based on the principle that the absorbance of a mixed solution is reduced due to the fact that the ascorbic acid can react with TMBOX, the high-sensitivity ascorbic acid colorimetric sensor composed of Ce-UiO-66-NH2 nano-enzyme particles with the diameter of 10-50 nm and a chromogenic substrate 3, 3 ', 5, 5'-tetramethyl benzidine (TMB) is constructed. Compared with MnO2, Pt-BGP NCs, CeO2 (at) PTA HNS and Co-PB NCs, the prepared ascorbic acid high-sensitivity colorimetric sensor has the advantages that the reaction time is shorter, and the content of ascorbic acid can be rapidly measured within 15 seconds. Based on the principle, the invention further provides a portable colorimetric test paper for visually detecting the ascorbic acid, and the ascorbic acid in the liquid lemon water can be semi-quantitatively detected by naked eyes within 30 seconds.

The application discloses a kind of biological tissue section rigidity measurement methods based on photonic crystal colorimetric sensor, the method is according to the set step pitch vertically to photonic crystal colorimetric sensor and is pressed down to tissue section, photonic crystal colorimetric sensor is formed by the elastomer of better biocompatibility and is covered photonic crystal, its Young's modulus can be adjusted according to the rigidity range of tissue section, in the process of pressing down, the different deformation of elastomer due to the rigidity of different regions of tissue, the wavelength of internal photonic crystal reflection changes, that is, the color difference of sensor surface is generated, then the rigidity information of tissue section is obtained according to the color difference analysis.The method realizes the rigidity of biological tissue section fast, simple, high-precision detection, and can be applied to the fields such as tissue engineering, organ chip, clinical examination and the like.

Disclosed are a nano colorimetric sensor based on natural pigment signal enhancement and a preparation method thereof, the nano colorimetric sensor being a nano colorimetric sensor array formed by nano colorimetric materials, the nano colorimetric materials comprising POEs materials and natural pigments. After 6 POEs materials and 4 natural pigments are respectively self-assembled under magnetic stirring, the nano colorimetric materials with sensitization effect are screened through RGB response values and Euclidean distances, the precursor substance mass ratio is optimized, and finally the sensitization effect is verified. The nano colorimetric sensor has high sensitivity, the colorimetric material is green and environmentally friendly, and can effectively realize rapid quantitative detection of the freshness of aquatic products, and has important practical significance in meeting the needs of consumers for food quality and safety and maintaining market order.

The invention relates to a non-toxic luminescence-based colorimetric sensor and methods of using the sensor in food contact and similar applications. The luminescence-based sensor can be used to assess oxygen concentration, particularly in controlled oxygen atmospheres such as food packaging.

The present invention provides a medium-entropy oxide nanofoam enzyme and its preparation method and application, which belongs to the field of nanozyme technology. The preparation method of the medium-entropy oxide nanofoam enzyme comprises the following steps: nickel salt, iron salt, manganese salt, urea and molten salt 1 are mixed with a grinding aid and then ground to obtain a mixture A; the mixture A is added to a molten salt 2 in a molten state, and then cooled to room temperature, and finally washed and dried to obtain the medium-entropy oxide nanofoam enzyme. In the low-high temperature molten salt assisted calcination method of the present invention, the use of low-high temperature molten salt effectively inhibits the agglomeration of the entropy oxide in FeNiMnO4 during the preparation process, forming a nano-foam structure. The colorimetric sensor constructed based on the FeNiMnO4 medium-entropy oxide nanofoam enzyme exhibits excellent detection performance, and its detection limit (LOD) can be as low as 0.98mU / mL, while also having excellent stability.

1. Name of the product in this design: Colorimetric sensor. 2. Purpose of this design: As a colorimetric sensor. 3. The key design feature of this product is its shape. 4. The image or photograph that best illustrates the design's key features: the front view.

The invention discloses an ammonia colorimetric sensor for detecting meat freshness. According to the sensor, cellulose aerogel is used as a sensing base material, the natural pigment hematoxylin is used as an indicator, and the natural pigment loaded bio-based ammonia colorimetric sensor is constructed by utilizing the characteristics of high porosity and large specific surface area of the cellulose aerogel and the characteristic that the hematoxylin is sensitive to the change of a pH value. And when the freshness of meat is reduced, ammonia gas and other substances can be released, so that the pH value of the environment is changed, and the color of the hematoxylin is changed, so that the putrefaction degree of food can be intuitively reflected. In order to improve the practicability of the sensor in a complex environment, methyl trimethoxy silane is used for carrying out hydrophobic modification treatment on the surface of the cellulose aerogel, and the treatment can effectively inhibit the interference of moisture on the cellulose aerogel. The invention provides a convenient, sensitive, rapid and efficient solution for detecting the freshness of the food.

The present application relates to a kind of metal-organic framework mediated multi-enzyme nanoparticles and its application, especially the method for alpha-amylase detection. By detecting product absorbance, the quantitative detection of alpha-amylase activity is realized. According to the nature of MFM analog enzyme and its ability as natural enzyme carrier, Agl@MFM@Gox@MFM is prepared, compared with natural enzyme, the composite material has strong resistance, can successfully protect the activity of enzyme. Based on the cascade catalytic system of multi-enzyme nanoparticles Agl@MFM@Gox@MFM, a biosensor is first synthesized and established for detecting alpha-amylase, successfully combines chemical catalyst with natural enzyme, has wide detection linear range (5-500 U / L) while has excellent specificity to alpha-amylase. Benefited from the advantages of low cost, easy preparation and excellent stability, the colorimetric sensor has been successfully used to determine the activity of alpha-amylase in koji.

The invention relates to the technical field of harmful substance detection, in particular to a three-channel colorimetric sensor for simultaneously detecting aflatoxin and a precursor thereof as well as a preparation method and application of the three-channel colorimetric sensor. According to the method, COFFe / NiP-Ph is utilized for catalyzing 3, 3 ', 5, 5'-tetramethylbenzidine (TMB) to be oxidized to generate blue oxTMB, o-phenylenediamine (OPD) is utilized for generating yellow oxOPD, and then the aflatoxin and the precursor thereof are detected through a three-channel colorimetric sensor. Purple ox4-AT is generated by using a mixture of N-ethyl-N-(3-sulfopropyl)-3-methylaniline sodium and 4-aminoantipyrine (4-AT), so that the colorimetric response is realized in a short time. The preparation method of the COFFe / NiP-Ph nano enzyme comprises the following steps: 1, a synthesis process of Fe-TAPP; 2, synthesis of Ni-TAPP is carried out; and 3, synthesizing the iron / nickel porphyrin covalent organic framework. The colorimetric sensor can be prepared into a detection reagent or a kit so as to realize qualitative and quantitative detection of aflatoxin and a precursor thereof in a sample to be detected. The detection method is simple and convenient to operate, and complex pretreatment on a to-be-detected sample is not needed; the detection cost is low, the detection is quick, and the requirement on a detection instrument is low.

This invention introduces an advanced odor detection and classification system that integrates optical and conductive sensors with artificial intelligence for precise, real-time identification of odor profiles across diverse fields. The system employs a colorimetric sensor to capture CIELAB values and a conductive sensor to measure voltage, with data processed through a Neural Network model. This model is trained on an extensive dataset to recognize and predict odors, adapting to variations in odor intensity for enhanced accuracy. Designed for high selectivity, stability, and resilience to environmental factors, the system is ideal for applications in medical diagnostics, food quality control, environmental monitoring, and industrial safety.

This invention discloses a method for preparing amorphous Cu-MOFs and their applications, relating to the field of metal-organic framework materials technology. The key technical points are: CuCl2 is used as the copper source and 4,4′-bipyridine as the ligand, and Cu-MOFs are synthesized via a solvothermal method. Transmission electron microscopy shows that the obtained material exhibits a typical micron-scale sheet-like morphology. After etching with ammonia, the sample morphology transforms into rough-surfaced nanospheres with a significantly increased pore size, indicating a local rearrangement of its framework structure. X-ray diffraction analysis shows that the original Cu-MOF has high crystallinity, while the diffraction peaks of the etched aCu-MOF essentially disappear, exhibiting amorphous characteristics. As a signal conversion element in a colorimetric sensor, aCu-MOF can achieve reliable detection of ampicillin under neutral conditions. Using thiram as a cofactor, a highly selective thiram colorimetric sensing system can be constructed.

The present application relates to the field of nanomaterials and analytical detection technology, in particular to a reagent for rapid detection of aureomycin and a rapid detection method of aureomycin. After adding 3-mercaptopropionic acid modified AgInS2 quantum dots to aureomycin, the fluorescence intensity and color of AgInS2 QDs change due to electrostatic interaction and band gap transition, thereby constructing a fluorescence colorimetric sensor to realize the ultra-sensitive detection of aureomycin. In order to realize the on-site detection of aureomycin, a portable device equipped with a smartphone and integrated with the AgInS2 QDs sensor is also designed. The cloud server data analysis system based on machine learning algorithm is integrated into the smartphone, which is convenient for color data collection, correction, interpretation and display. The present application utilizes the function of modern smartphones to capture and process fluorescence color signals, thereby providing a user-friendly on-site detection solution for aureomycin detection.

The application discloses a heavy atom enhanced calix cyanine dye radioactivity detection colorimetric sensor, the dye is prepared by introducing heavy atoms in the calix cyanine dye skeleton, and the radiation sensitivity is significantly improved; the dye reacts with hydroxyl radicals generated by water radiolysis under the action of radiation, conjugate structure is destroyed, and color change from green to yellow is generated; the application comprises a colorimetric test strip prepared from the dye, and a detection system integrated with a smartphone image recognition function, the test strip comprises a base material and an additive; the additive comprises a copolymer, and preparation reaction monomers of the copolymer comprise N,N-diethylaminoethyl acrylate and 3-methylpent-2-ene dimethyl acid; the application has the advantages of high sensitivity, low cost, simple operation, portability and the like, can be used for rapid, visual and quantitative detection of radionuclides in water solution, urine and the like samples, and has important application value in the field of nuclear medicine radiation safety monitoring.

This invention relates to the field of tetracycline detection technology, specifically disclosing an iron porphyrin hydrogen-bonded organic framework nanozyme, its preparation method, and its applications. The iron porphyrin hydrogen-bonded organic framework nanozyme comprises an iron porphyrin hydrogen-bonded organic framework, gold nanoparticles, and a tetracycline nucleic acid aptamer. The gold nanoparticles are non-covalently loaded onto the surface and pores of the iron porphyrin hydrogen-bonded organic framework, and the tetracycline nucleic acid aptamer and gold nanoparticles are connected by coordination covalent bonds. The iron porphyrin hydrogen-bonded organic framework nanozyme exhibits peroxide-like nanozyme activity, catalyzing the oxidation of the chromogenic substrate TMB in the presence of H₂O₂ to detect tetracycline content. By introducing the hydrogen-bonded organic framework and the tetracycline nucleic acid aptamer, the detection specificity is improved, achieving highly sensitive, highly selective, and rapid detection of tetracycline. The colorimetric sensor constructed based on the iron porphyrin hydrogen-bonded organic framework nanozyme provides a new method for rapid and visual detection of tetracycline in feed.

The present invention relates to a luminescence-based colorimetric sensor and to methods of use thereof. The sensor can be used to assess oxygen concentration, in particular in controlled oxygen atmospheres such as food packaging. In embodiments, the invention also relates to thin-film oxygen sensors, in particular for food packaging applications.

The invention discloses a DNA framework nucleic acid cascade enzyme, a paper-based colorimetric sensor and a preparation method and application of the paper-based colorimetric sensor, and belongs to the technical field of biological detection.The DNA framework nucleic acid cascade enzyme comprises a first enzyme, a second enzyme, a first DNA tetrahedron and a second DNA tetrahedron; the first enzyme is glucose oxidase with the surface modified by DBCO-pri, and the second enzyme is horse radish peroxidase with the surface modified by DBCO-pri; the first enzyme and the first DNA tetrahedron as well as the second enzyme and the second DNA tetrahedron are respectively connected through base complementary pairing; the first DNA tetrahedron and the second DNA tetrahedron are hybridized through a nucleic acid connecting chain to form a dimer structure. According to the invention, the DNA nanostructure is used for accurately fixing enzyme molecules and controlling the spatial arrangement of the enzyme molecules, the cascade catalytic efficiency is improved, and the advantages of low cost and portability of a paper-based platform are combined, so that high-sensitivity, rapid and visual detection of sweat glucose is realized.

An apparatus having: a container, a first openable vessel within the container, an analyte within the first vessel, and a vapochromic sensor within the container. The vapochromic sensor changes color on contact with a vapor of the analyte.

The invention discloses a V2C / CeO2 compound and a preparation method and application thereof.Ce (NO3) 3, NaOH and V2C serve as raw materials, vanadium carbide and cerium oxide (V2C / CeO2) is synthesized through a hydrothermal method, the crystal face of CeO2 is changed through V2C, the morphology of CeO2 is changed, the electron transmission capacity is improved, then the oxidase-like activity is improved, the high oxidase-like activity and stability are achieved, and the V2C / CeO2 compound can be used for preparing a composite material with the high oxidase-like activity and stability. The problems of low catalytic activity and poor selectivity of cerium oxide in ascorbic acid detection are solved. A colorimetric sensor for ascorbic acid detection can be manufactured based on the V2C / CeO2 compound, and the compound has the advantages of being low in cost, high in stability and easy to store.

The invention discloses a sensor-enabled wound monitoring and treatment device. In some embodiments, a wound dressing may be used that includes a plurality of sensors or sensors separate from the wound dressing to monitor characteristics of the wound or identify one or more risk factors or conditions that may trap the wound as the wound heals. In some embodiments, a wound dressing configured to be positioned in contact with a wound includes a substantially flexible substrate supporting one or more sensors. The one or more sensors may include a temperature sensor, a conductivity sensor, a multispectral optical measurement sensor, a pH sensor, a pressure sensor, a colorimetric sensor, an optical sensor, an ultraviolet (UV) sensor, or an infrared (IR) sensor.

The invention provides a visual colorimetric sensor, a preparation method thereof and a method for detecting nitrite, the visual colorimetric sensor comprises a substrate and a color developing functional layer, the color developing functional layer is loaded on the substrate through a hydrogen bond, the substrate comprises a cellulose membrane, and the color developing functional layer comprises a TMB material. According to the invention, the cellulose membrane is used as the substrate and the hydrogen bond is used for loading the TMB to form the color developing functional layer, so that the contact area between the TMB and nitrite ions is increased due to the porous characteristic of the cellulose membrane, and the TMB is reduced in loss due to stable loading, so that the reaction is more sufficient to realize high-sensitivity detection; by means of the specific chromogenic reaction of TMB and nitrite ions and the extremely strong anti-interference ability, it is ensured that detection is accurate and high in selectivity in a complex sample, meanwhile, color change is visual and distinguishable, visual detection easy and convenient to operate is achieved, and finally the detection requirements of the World Health Organization and the national standard for nitrite in food are met.

The application discloses a preparation method of copper-6-mercaptopurine metal organic gel and application thereof in perfluorooctyl sulfonic acid detection, and belongs to the technical field of optical sensing, wherein the preparation method takes 6-mercaptopurine as a reducing agent and a complexing agent, and prepares copper-6-mercaptopurine metal organic gel through a hydrothermal method. The copper-6-mercaptopurine metal organic gel prepared by the application has very high peroxidase-like activity, can efficiently catalyze a substrate 3,3',5,5'-tetramethylbenzidine (TMB) to generate an oxidation product TMB (oxTMB) in the presence of H2O2, and thus can be used as a novel peroxide mimicking nano-enzyme. The application also discloses a colorimetric sensor based on the above copper-6-mercaptopurine metal organic gel and used for perfluorooctyl sulfonic acid detection.

The present invention relates to a breather for a transformer and, more particularly, to a breather for a transformer, in which a colorimetric sensor, which changes color in response to moisture, is mounted inside the breather that regulates internal pressure of the transformer and removes moisture generated therein, such that a replacement timing of the breather can be easily identified from the outside on the basis of whether a color change has occurred, and a check valve is installed inside the breather to automatically discharge and reduce internal pressure of the transformer when the pressure rises, and to automatically reset when the pressure falls below a predetermined level, thereby blocking the inflow of external air.

This invention discloses a molecularly imprinted paper-based microfluidic colorimetric sensor for detecting histamine, its preparation, and its application. The colorimetric sensor (MIP@MIL) is polymerized from a metal-organic framework (MIL-101) using surface molecular imprinting and dual-monomer imprinting techniques. MIP@MIL exhibits a histamine detection limit of 0.77 μM and a detection time of 12.5 min, demonstrating good selectivity. The mechanism involves histamine blocking the imprinted pores of MIP@MIL and acting on MIL-101, thereby weakening the catalytic oxidation process of the chromogenic agent 2,2'-azido-bis-3-ethylbenzothiazoline-6-sulfonic acid (ABTS). Furthermore, histamine increases the repulsive force of MIP@MIL against ABTS, thus enabling colorimetric detection of histamine. To further improve practical applicability, MIP@MIL was loaded onto qualitative filter paper and further modified onto microfluidic paper-based chips (μPADs). Using a smartphone, rapid and accurate visual detection of histamine in food was achieved, demonstrating its potential for food freshness detection.

A method for preparing an ultraviolet (UV)-degradable and functionalized cellulose paper-based colorimetric sensor, in which a TiO2-loaded cellulose filter paper is prepared, from which a TiO2 / OTS-loaded functionalized cellulose filter paper is prepared; and the TiO2 / OTS-loaded functionalized cellulose filter paper is combined with colorimetric materials to obtain the UV-degradable and functionalized cellulose paper-based colorimetric sensor with multiple hydrophilic dye-loading regions and a hydrophobic isolation region. This application further provides a food quality evaluation method, in which a food quality evaluation model is established based on the UV-degradable and functionalized cellulose paper-based colorimetric sensor.