High salt tolerant sensor based on functional nucleic acid of zinc and application thereof

A functional nucleic acid and sensor technology, applied in instruments, scientific instruments, genetic engineering, etc., can solve the problems of high price, poor selectivity, low sensitivity, etc., and achieve the effects of low cost, high specificity and sensitivity, and high sensitivity

Active Publication Date: 2018-04-27
CHINA AGRI UNIV
View PDF7 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Traditional zinc detection methods can generally be divided into cold atomic absorption spectrometry, graphite carbon atomic absorption spectrometry and flame atomic absorption spectrometry, etc., but generally have the characteristics of low sensitivity, poor selectivity, susceptible to interference, and expensive

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • High salt tolerant sensor based on functional nucleic acid of zinc and application thereof
  • High salt tolerant sensor based on functional nucleic acid of zinc and application thereof
  • High salt tolerant sensor based on functional nucleic acid of zinc and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0063] Example 1: Construction of a high-salt-resistant sensor based on zinc-based functional nucleic acid

[0064] 1. Experimental materials

[0065] Potassium Chloride, Sodium Chloride, Magnesium Chloride, Potassium Hydrogen Phosphate, Disodium EDTA, Sulfuric Acid, Tetramethylbenzidine, Hemin, Zinc Chloride, Urea, Nt.BstNBI Notch Endonuclease, Bst DNA polymerase, 4-hydroxyethylpiperazineethanesulfonic acid (HEPES), sodium hydroxide, disodium hydrogen phosphate.

[0066] 2. Sequence design

[0067] Design and synthesize DNAzyme substrate strands, DNAzyme enzyme strands, and amplification templates. In the amplification template, GACTC is the Nt.BstNBI nicking endonuclease recognition sequence, and the first four base pairs of the sequence (between C and A) are the synthetic chain cleavage sites; the zinc ion cleavage site is at the base of the deoxyribozyme After rA of the object chain.

[0068]

[0069] 3. Construction method

[0070] The construction method of the h...

Embodiment 2

[0087] Embodiment 2: the detection of zinc ion

[0088] The zinc ion solution to be measured is a zinc chloride solution (NaCl is a dissolution environment), and the specific steps are as follows:

[0089] (1) Prepare OD 450 Standard curve with the change of zinc ion concentration

[0090] Using the construction method of 3 in Example 1, the zinc ion solution to be tested is a zinc chloride solution of different concentrations (1M NaCl is the dissolution environment), and the zinc ion concentration is 0nM, 30nM, 60nM, 90nM, 120nM and 150nM, and the OD 450 The standard curve with the change of zinc ion concentration ( image 3 ), the standard curve is y=0.0091x+0.1274, R 2 = 0.9917.

[0091] (2) adopt the construction method of 3 in the embodiment 1, the OD of the zinc ion solution to be tested is measured by a microplate reader 450 , into the standard curve y=0.0091x+0.1274 to obtain the zinc ion concentration. The results are shown in Table 1

[0092] Table 1

[0093]...

Embodiment 3

[0094] Embodiment 3: A kind of test kit that detects zinc ion

[0095] A kit for detecting zinc ions, comprising a zinc ion deoxyribozyme system, an isothermal amplification system and a color development system;

[0096] Zinc ion deoxyribozyme system includes substrate chain, enzyme chain, buffer, zinc ion standard solution and stop solution;

[0097] The isothermal amplification system includes amplification template, dNTPs, ultrapure water, Bst DNA polymerase, polymerase reaction buffer solution, Nt.BstNBI nicking endonuclease and Nt.BstNBI nicking endonuclease reaction buffer solution;

[0098]The chromogenic system includes: hemin, enzyme activity buffer, TMB chromogenic reagent and 2MH 2 SO 4 .

[0099] The sequence (5'-3') of the DNAzyme substrate chain is: CCACCACAATGTTATACAGGTACTATrAGGAAGTTGAGTTACGAGGCGGTGGTGG;

[0100] The sequence (5'-3') of the deoxyribozyme enzyme chain is: CTCAACTTCTCCGAGCCGGTCGAAATAGTACCT;

[0101] The sequence (5'-3') of the amplification ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Belonging to the technical field of metal detection, the invention discloses a high salt tolerant sensor based on functional nucleic acid of zinc and application thereof. The high salt tolerant sensorcomprises a molecular recognition element, a signal amplification element, and a signal conversion element. The molecular recognition element consists of zinc ion deoxyribozyme, the zinc ion deoxyribozyme consists of a substrate chain and an enzyme chain. The signal amplification element includes an isothermal amplification system and hemin. The isothermal amplification system includes an amplification template. The signal conversion element comprises a color developing agent. The sensor provided by the invention is constructed based on zinc ion deoxyribozyme, isothermal index amplification reaction and G-quadruplex liquid phase sensing technology, can be used for field detection of zinc ions in the environment, and has the advantages of simplicity and rapidity, low cost, high salt tolerance, high sensitivity and good selectivity, and especially can realize visual detection.

Description

technical field [0001] The invention belongs to the technical field of ion detection, and in particular relates to a zinc-based functional nucleic acid high-salt-resistant sensor and an application thereof. Background technique [0002] Heavy metal zinc (Zinc, Zn) is a metal element widely distributed in nature, mainly exists in the state of zinc sulfide and zinc oxide, and can also coexist with many minerals such as lead, copper, and zinc. Zinc pollution refers to the environmental pollution caused by zinc and its compounds. The main sources of pollution are zinc mining, smelting and processing, machinery manufacturing, galvanizing, instrumentation, organic synthesis, and papermaking industries. Automobile tire wear and dust and smoke produced by coal combustion all contain zinc and its compounds. Zinc in industrial wastewater often exists in the form of zinc hydroxyl complexes. [0003] Zinc is the most abundant trace element in the human body. Its content is as high as ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): G01N21/78G01N33/53G01N33/535C12Q1/6844C12Q1/6825C12N15/113
CPCC12N15/113C12N2310/12C12Q1/6825C12Q1/6844G01N21/78G01N33/5308G01N33/535C12Q2521/345
Inventor罗云波许文涛黄昆仑田晶晶杜再慧肖冰董凯
OwnerCHINA AGRI UNIV