High salt tolerant sensor based on functional nucleic acid of zinc and application thereof
A functional nucleic acid and sensor technology, applied in instruments, scientific instruments, genetic engineering, etc., can solve the problems of high price, poor selectivity, low sensitivity, etc., and achieve the effects of low cost, high specificity and sensitivity, and high sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0063] Example 1: Construction of a high-salt-resistant sensor based on zinc-based functional nucleic acid
[0064] 1. Experimental materials
[0065] Potassium Chloride, Sodium Chloride, Magnesium Chloride, Potassium Hydrogen Phosphate, Disodium EDTA, Sulfuric Acid, Tetramethylbenzidine, Hemin, Zinc Chloride, Urea, Nt.BstNBI Notch Endonuclease, Bst DNA polymerase, 4-hydroxyethylpiperazineethanesulfonic acid (HEPES), sodium hydroxide, disodium hydrogen phosphate.
[0066] 2. Sequence design
[0067] Design and synthesize DNAzyme substrate strands, DNAzyme enzyme strands, and amplification templates. In the amplification template, GACTC is the Nt.BstNBI nicking endonuclease recognition sequence, and the first four base pairs of the sequence (between C and A) are the synthetic chain cleavage sites; the zinc ion cleavage site is at the base of the deoxyribozyme After rA of the object chain.
[0068]
[0069] 3. Construction method
[0070] The construction method of the h...
Embodiment 2
[0087] Embodiment 2: the detection of zinc ion
[0088] The zinc ion solution to be measured is a zinc chloride solution (NaCl is a dissolution environment), and the specific steps are as follows:
[0089] (1) Prepare OD 450 Standard curve with the change of zinc ion concentration
[0090] Using the construction method of 3 in Example 1, the zinc ion solution to be tested is a zinc chloride solution of different concentrations (1M NaCl is the dissolution environment), and the zinc ion concentration is 0nM, 30nM, 60nM, 90nM, 120nM and 150nM, and the OD 450 The standard curve with the change of zinc ion concentration ( image 3 ), the standard curve is y=0.0091x+0.1274, R 2 = 0.9917.
[0091] (2) adopt the construction method of 3 in the embodiment 1, the OD of the zinc ion solution to be tested is measured by a microplate reader 450 , into the standard curve y=0.0091x+0.1274 to obtain the zinc ion concentration. The results are shown in Table 1
[0092] Table 1
[0093]...
Embodiment 3
[0094] Embodiment 3: A kind of test kit that detects zinc ion
[0095] A kit for detecting zinc ions, comprising a zinc ion deoxyribozyme system, an isothermal amplification system and a color development system;
[0096] Zinc ion deoxyribozyme system includes substrate chain, enzyme chain, buffer, zinc ion standard solution and stop solution;
[0097] The isothermal amplification system includes amplification template, dNTPs, ultrapure water, Bst DNA polymerase, polymerase reaction buffer solution, Nt.BstNBI nicking endonuclease and Nt.BstNBI nicking endonuclease reaction buffer solution;
[0098]The chromogenic system includes: hemin, enzyme activity buffer, TMB chromogenic reagent and 2MH 2 SO 4 .
[0099] The sequence (5'-3') of the DNAzyme substrate chain is: CCACCACAATGTTATACAGGTACTATrAGGAAGTTGAGTTACGAGGCGGTGGTGG;
[0100] The sequence (5'-3') of the deoxyribozyme enzyme chain is: CTCAACTTCTCCGAGCCGGTCGAAATAGTACCT;
[0101] The sequence (5'-3') of the amplification ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


