10-23 desoxyribonuclease of bacillus resisting tubercle branch
A deoxyribozyme and mycobacterial technology, applied in the direction of antibacterial drugs, medical preparations containing active ingredients, enzymes, etc., can solve the problems of affecting efficacy and unfavorable combination
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] The design and synthesis of each 10-23 deoxyribozyme of the present invention:
[0033] The sequence of the Mycobacterium tuberculosis H37Rv icl gene was retrieved from GenBank, and the secondary structure of the icl mRNA was simulated by using the software RNA Structrur3.7. According to the simulated structure diagram ( figure 2 ) Select the protruding loop part of the secondary structure that is easy to combine with the deoxyribozyme and meet the requirements of the 10-23 deoxyribozyme target site as the initial target site for cutting. According to the sequence of each target site, 10-23 deoxyribozymes complementary to it and with different substrate-binding domain lengths were designed.
[0034] The 10- The total hybridization free energy ΔG of the 23 deoxyribozyme and the substrate RNA, select the 10-23 deoxyribozyme for different initial target positions, and the ΔG is in the range of -20<ΔG<-25 as the initial 10-23 deoxyribozyme Ribozyme.
[0035] Oligo5.0 so...
Embodiment 2
[0045] Acquisition of Mycobacterium tuberculosis icl mRNA:
[0046] Extract Mycobacterium tuberculosis H37Rv (purchased from the Institute of Microbiology, Chinese Academy of Sciences, and also available from the Chinese strain Preservation Center, purchased from the American Type Culture Collection.) Genomic DNA. P1 and P2 primers were designed according to the ICL coding sequence registered in GenBank.
[0047] P1: 1 gcggatccaccgttaaggagttgtct 26
[0048] P2: 1 gcaagcttctagtggaactggccct 25
[0049] The icl gene was obtained by PCR reaction using the genomic DNA of Mycobacterium tuberculosis H37Rv as a template ( FIG. 3A ).
[0050] PCR reaction parameters:
[0051] Template DNA: 2 μl
[0052] 10×PCR buffer (containing magnesium chloride): 5 μl
[0053] dNTP (10mmol / L): 2μl
[0054] Primer P1: 1 μl
[0055] Primer P2: 1 μl
[0056] Taq plus DNA polymerase (5u / μl): 1μl
[0057] Add sterile deionized water to a final volume of 50 μl
[0058] PCR reaction conditions: ...
Embodiment 3
[0071] Observation of the cutting effect of each 10-23 deoxyribozyme on icl mRNA:
[0072] Add corresponding reagents (μL) to 5 EP tubes according to the table below:
[0073] 1 2 3 4 5
[0074] Tris-Hcl (PH7.0, 0.25mol / L) 2 2 2 2 2
[0075] icl mRNA (700μg / ml) 2 2 2 2 2
[0076]Mgcl2(0.1mmol / L) 1.5 1.5 1.5 1.5 1.5
[0077] 10-23 deoxyribozyme (1 μmol / L) 2 (SEQ ID NO: 1) 2 (SEQ ID NO: 2) 2 (SEQ ID NO: 3) 2 (SEQ ID NO: 4) -
[0078] DEPC treated deionized water 2.5 2.5 2.5 2.5 4.5
[0079] Each EP tube was incubated at 37°C for 60 minutes, then taken out, and separated by 3.5% denatured polyacrylamide gel electrophoresis. Then use the nucleic acid silver staining kit (purchased from Beijing Dingguo Company, also available from Beijing Zhongshan Company and Shanghai Shenggong Company) to carry out staining, collect images with a gel imaging system, measure the optical density value of each band, and calculate cut percentage. Cleavage percenta...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap