Unlock instant, AI-driven research and patent intelligence for your innovation.

10-23 desoxyribonuclease of bacillus resisting tubercle branch

A deoxyribozyme and mycobacterial technology, applied in the direction of antibacterial drugs, medical preparations containing active ingredients, enzymes, etc., can solve the problems of affecting efficacy and unfavorable combination

Inactive Publication Date: 2005-03-23
朱道银 +1
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

If the deoxyribozyme itself forms a relatively stable base pairing, it will not be conducive to its combination with the target RNA, thus affecting its efficacy

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • 10-23 desoxyribonuclease of bacillus resisting tubercle branch
  • 10-23 desoxyribonuclease of bacillus resisting tubercle branch
  • 10-23 desoxyribonuclease of bacillus resisting tubercle branch

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] The design and synthesis of each 10-23 deoxyribozyme of the present invention:

[0033] The sequence of the Mycobacterium tuberculosis H37Rv icl gene was retrieved from GenBank, and the secondary structure of the icl mRNA was simulated by using the software RNA Structrur3.7. According to the simulated structure diagram ( figure 2 ) Select the protruding loop part of the secondary structure that is easy to combine with the deoxyribozyme and meet the requirements of the 10-23 deoxyribozyme target site as the initial target site for cutting. According to the sequence of each target site, 10-23 deoxyribozymes complementary to it and with different substrate-binding domain lengths were designed.

[0034] The 10- The total hybridization free energy ΔG of the 23 deoxyribozyme and the substrate RNA, select the 10-23 deoxyribozyme for different initial target positions, and the ΔG is in the range of -20<ΔG<-25 as the initial 10-23 deoxyribozyme Ribozyme.

[0035] Oligo5.0 so...

Embodiment 2

[0045] Acquisition of Mycobacterium tuberculosis icl mRNA:

[0046] Extract Mycobacterium tuberculosis H37Rv (purchased from the Institute of Microbiology, Chinese Academy of Sciences, and also available from the Chinese strain Preservation Center, purchased from the American Type Culture Collection.) Genomic DNA. P1 and P2 primers were designed according to the ICL coding sequence registered in GenBank.

[0047] P1: 1 gcggatccaccgttaaggagttgtct 26

[0048] P2: 1 gcaagcttctagtggaactggccct 25

[0049] The icl gene was obtained by PCR reaction using the genomic DNA of Mycobacterium tuberculosis H37Rv as a template ( FIG. 3A ).

[0050] PCR reaction parameters:

[0051] Template DNA: 2 μl

[0052] 10×PCR buffer (containing magnesium chloride): 5 μl

[0053] dNTP (10mmol / L): 2μl

[0054] Primer P1: 1 μl

[0055] Primer P2: 1 μl

[0056] Taq plus DNA polymerase (5u / μl): 1μl

[0057] Add sterile deionized water to a final volume of 50 μl

[0058] PCR reaction conditions: ...

Embodiment 3

[0071] Observation of the cutting effect of each 10-23 deoxyribozyme on icl mRNA:

[0072] Add corresponding reagents (μL) to 5 EP tubes according to the table below:

[0073] 1 2 3 4 5

[0074] Tris-Hcl (PH7.0, 0.25mol / L) 2 2 2 2 2

[0075] icl mRNA (700μg / ml) 2 2 2 2 2

[0076]Mgcl2(0.1mmol / L) 1.5 1.5 1.5 1.5 1.5

[0077] 10-23 deoxyribozyme (1 μmol / L) 2 (SEQ ID NO: 1) 2 (SEQ ID NO: 2) 2 (SEQ ID NO: 3) 2 (SEQ ID NO: 4) -

[0078] DEPC treated deionized water 2.5 2.5 2.5 2.5 4.5

[0079] Each EP tube was incubated at 37°C for 60 minutes, then taken out, and separated by 3.5% denatured polyacrylamide gel electrophoresis. Then use the nucleic acid silver staining kit (purchased from Beijing Dingguo Company, also available from Beijing Zhongshan Company and Shanghai Shenggong Company) to carry out staining, collect images with a gel imaging system, measure the optical density value of each band, and calculate cut percentage. Cleavage percenta...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides four 10-23 deoxyribozymes that have anti-mycobacterium tuberculosis activity: SEQ IDNO:1, SEQ IDNO:2, SEQ IDNO:3 and SEQ IDNO:4, and as acting on different parts of mycobacterium tuberculosis iclmRNA, they can all cut off the iclmRNA, peculiarly to inhibit the expression of the mycobacterium tuberculosis icl gene and make the mycobacterium tuberculosis in a latent infection state unable to use fatty acid as carbon source, thus killing the mycobacterium tuberculosis in the latent state. For this, the invention provides the use of the above-mentioned deoxyribozymes in preparing curative medicines to cure tuberculosis, especially latent infection of tuberculosis.

Description

Technical field: [0001] The invention relates to 10-23 deoxyribozyme against mycobacterium tuberculosis and its use in preparing medicine for tuberculosis treatment, especially tuberculosis latent infection treatment. technical background: [0002] Tuberculosis is the number one cause of death from a single pathogenic bacterial disease. Every year, 9 million people worldwide get sick and about 3 million people die from tuberculosis. Although modern chemotherapy for tuberculosis has achieved great success, it is still difficult to shorten the course of treatment for smear-positive tuberculosis to less than 6 months. Many developing countries with severe epidemics still cannot afford the required medical expenses, and the long course of treatment also makes the Reduced compliance of patients can easily lead to insufficient chemotherapy for patients, which often results in a high recurrence rate after treatment, and is conducive to the emergence and prevalence of drug-resistant...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K38/43A61P31/06C12N9/00C12N15/52
Inventor 朱道银李俊明
Owner 朱道银
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More