Visual sensor based on functional nucleic acid of cadmium and application thereof

A functional nucleic acid and sensor technology, applied in the field of visual sensors, can solve problems such as high cost, low sensitivity, and complicated operation, and achieve the effects of low cost, high sensitivity, and high specificity

Active Publication Date: 2018-04-27
CHINA AGRI UNIV
View PDF9 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] In order to solve the technical problems of low sensitivity, complex operation and hi

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Visual sensor based on functional nucleic acid of cadmium and application thereof
  • Visual sensor based on functional nucleic acid of cadmium and application thereof
  • Visual sensor based on functional nucleic acid of cadmium and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0063] Example 1: Construction of Visual Sensor Based on Cadmium-Based Functional Nucleic Acids

[0064] 1. Experimental materials

[0065] Potassium Chloride, Sodium Chloride, Magnesium Chloride, Potassium Hydrogen Phosphate, Disodium EDTA, Sulfuric Acid, Tetramethylbenzidine, Hemin, Cadmium Chloride, Urea, Nt.BstNBI Notch Endonuclease, Bst DNA polymerase, 4-hydroxyethylpiperazineethanesulfonic acid (HEPES), sodium hydroxide, disodium hydrogen phosphate.

[0066] 2. Sequence design

[0067] Design and synthesize cadmium ion DNAzyme substrate chain, DNAzyme enzyme chain and amplification template. In the amplification template, GACTC is the Nt.BstNBI nicking endonuclease recognition sequence, and the first four base pairs of the sequence (between C and A) are the synthetic strand cleavage sites; the CGGCCGGG sequence at the end of the deoxyribozyme substrate chain is In order to increase the binding Tm value with the amplified template; the cadmium ion cutting site is after...

Embodiment 2

[0087] Embodiment 2: the detection of cadmium ion

[0088] In the present embodiment, the cadmium ion solution to be measured is a cadmium chloride solution (NaCl is a dissolution environment), and the detection specific steps of the cadmium ion are as follows:

[0089] (1) Prepare OD 450Standard curve with the concentration of cadmium ion

[0090] Using the method of 3 in Example 1, the cadmium ion solution to be measured is a different concentration of cadmium chloride solution (1MNaCl is the dissolution environment), and the cadmium chloride concentration is 15uM, 30uM, 45uM, 60uM, 75uM, 90uM and 115uM, and the OD 450 The standard curve with the concentration of cadmium ion ( image 3 ), the standard curve is y=0.009x-0.017, R 2 = 0.996.

[0091] (2) adopt the method for 3 in embodiment 1, microplate reader measures the OD of cadmium ion solution to be measured 450 , put into the standard curve as y=0.009x-0.017 to obtain the cadmium ion concentration. The relevant re...

Embodiment 3

[0094] Embodiment 3: A kind of kit that detects cadmium ion

[0095] A kit for detecting cadmium ions, comprising a cadmium ion deoxyribozyme system, an isothermal amplification system and a display system;

[0096] Cadmium ion deoxyribozyme system includes substrate chain, enzyme chain, buffer, cadmium ion standard solution and stop solution;

[0097] The isothermal amplification system includes amplification template, dNTPs, ultrapure water, Bst DNA polymerase, polymerase reaction buffer solution, Nt.BstNBI nicking endonuclease and Nt.BstNBI nicking endonuclease reaction buffer solution;

[0098] The display system includes: hemin, enzyme activity buffer, TMB chromogen and 2MH 2 SO 4 .

[0099] The sequence (5'-3') of the DNAzyme substrate chain is: CTCACGAGTCACTATrA*GGAAGATGGCGAAACGGGGCCGG;

[0100] The sequence (5'-3') of the deoxyribozyme enzyme chain is: ATCTTCCTTCGATAGTTAAAATAGTGACTCGTGAC;

[0101] The sequence (5'-3') of the amplification template is: CCCTACCCGCCC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

Belonging to the technical field of metal ion detection, the invention discloses a visual sensor based on functional nucleic acid of cadmium and application thereof. The sensor consists of a molecularrecognition component, a signal amplification component and a signal conversion component. The molecular recognition component is composed of cadmium ion deoxyribozyme, which comprises a substrate chain and an enzyme chain. The signal amplification component includes an isothermal amplification system and hemin, and the isothermal amplification system includes an amplification template. The signal conversion component includes a color developing agent. The visual sensor is constructed based on cadmium ion deoxyribozyme, isothermal index amplification reaction and G-quadruplex liquid phase sensing technology, has the advantages of simplicity and rapidity, high sensitivity, high specificity, high salt resistance, low cost and the like, and can be used for field detection of cadmium ions inthe environment.

Description

technical field [0001] The invention belongs to the technical field of metal ion detection, and in particular relates to a cadmium-based visual sensor of functional nucleic acid and an application thereof. Background technique [0002] Cadmium is a blue-white, important, transition-state heavy metal element, which is toxic, but is widely used in industrial production due to its good flexibility and oxidation resistance. In the 1960s, cadmium poisoning was reported for the first time in Japan, which attracted people's attention. Studies have shown that cadmium can enter the organism through the respiratory tract and digestive tract, and the cadmium entering the body can cause damage to a series of important organs such as liver, kidney, bone, brain and lung, and also cause damage to the nervous, reproductive and immune systems. [0003] Liver and kidney are the main target organs of cadmium poisoning, and the toxicity of cadmium to liver and kidney shows obvious time-concent...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): G01N21/78G01N21/25
CPCG01N21/25G01N21/78
Inventor 罗云波许文涛黄昆仑田晶晶肖冰杜再慧董凯
Owner CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap