Visual sensor based on functional nucleic acid of cadmium and application thereof
A functional nucleic acid and sensor technology, applied in the field of visual sensors, can solve problems such as high cost, low sensitivity, and complicated operation, and achieve the effects of low cost, high sensitivity, and high specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0063] Example 1: Construction of Visual Sensor Based on Cadmium-Based Functional Nucleic Acids
[0064] 1. Experimental materials
[0065] Potassium Chloride, Sodium Chloride, Magnesium Chloride, Potassium Hydrogen Phosphate, Disodium EDTA, Sulfuric Acid, Tetramethylbenzidine, Hemin, Cadmium Chloride, Urea, Nt.BstNBI Notch Endonuclease, Bst DNA polymerase, 4-hydroxyethylpiperazineethanesulfonic acid (HEPES), sodium hydroxide, disodium hydrogen phosphate.
[0066] 2. Sequence design
[0067] Design and synthesize cadmium ion DNAzyme substrate chain, DNAzyme enzyme chain and amplification template. In the amplification template, GACTC is the Nt.BstNBI nicking endonuclease recognition sequence, and the first four base pairs of the sequence (between C and A) are the synthetic strand cleavage sites; the CGGCCGGG sequence at the end of the deoxyribozyme substrate chain is In order to increase the binding Tm value with the amplified template; the cadmium ion cutting site is after...
Embodiment 2
[0087] Embodiment 2: the detection of cadmium ion
[0088] In the present embodiment, the cadmium ion solution to be measured is a cadmium chloride solution (NaCl is a dissolution environment), and the detection specific steps of the cadmium ion are as follows:
[0089] (1) Prepare OD 450Standard curve with the concentration of cadmium ion
[0090] Using the method of 3 in Example 1, the cadmium ion solution to be measured is a different concentration of cadmium chloride solution (1MNaCl is the dissolution environment), and the cadmium chloride concentration is 15uM, 30uM, 45uM, 60uM, 75uM, 90uM and 115uM, and the OD 450 The standard curve with the concentration of cadmium ion ( image 3 ), the standard curve is y=0.009x-0.017, R 2 = 0.996.
[0091] (2) adopt the method for 3 in embodiment 1, microplate reader measures the OD of cadmium ion solution to be measured 450 , put into the standard curve as y=0.009x-0.017 to obtain the cadmium ion concentration. The relevant re...
Embodiment 3
[0094] Embodiment 3: A kind of kit that detects cadmium ion
[0095] A kit for detecting cadmium ions, comprising a cadmium ion deoxyribozyme system, an isothermal amplification system and a display system;
[0096] Cadmium ion deoxyribozyme system includes substrate chain, enzyme chain, buffer, cadmium ion standard solution and stop solution;
[0097] The isothermal amplification system includes amplification template, dNTPs, ultrapure water, Bst DNA polymerase, polymerase reaction buffer solution, Nt.BstNBI nicking endonuclease and Nt.BstNBI nicking endonuclease reaction buffer solution;
[0098] The display system includes: hemin, enzyme activity buffer, TMB chromogen and 2MH 2 SO 4 .
[0099] The sequence (5'-3') of the DNAzyme substrate chain is: CTCACGAGTCACTATrA*GGAAGATGGCGAAACGGGGCCGG;
[0100] The sequence (5'-3') of the deoxyribozyme enzyme chain is: ATCTTCCTTCGATAGTTAAAATAGTGACTCGTGAC;
[0101] The sequence (5'-3') of the amplification template is: CCCTACCCGCCC...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



