A method for species identification of edible sea cucumber based on DNA microbarcoding technology
A micro-barcode and species identification technology, applied in the field of molecular biology, can solve the problems of destruction and inability to extract COI genes, etc., and achieve the effect of simple operation, species identification and high accuracy
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0012] The present invention is further described by means of examples, but the present invention is not limited only to the following examples.
[0013] This embodiment is to evaluate the accuracy of the DNA micro-barcode amplification efficiency and identification of sea cucumbers through the following tests.
[0014] 1. Primer Design
[0015] Download the COI gene sequences of different species of edible sea cucumbers from the NCBI website, and use
[0016] MEGA6.0 software performs multiple alignments on sequences, removes identical sequences, and finds conserved regions. A pair of DNA micro-barcode primers MiniCOI-F: CATGGCTTTCCCTCGAATGAA, MiniCOI-R: TAACTCCTGGGGTTCGCATCT were designed using the conserved region combined with primmer5.0 software.
[0017] Table 1 PCR primers and their annealing temperature
[0018]
[0019] 2. Extraction of Genomic DNA from Samples
[0020] The improved CTAB method was used to extract sea cucumber DNA from 28 sea cucumber samples w...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com