A method for species identification of edible sea cucumber based on DNA microbarcoding technology

A micro-barcode and species identification technology, applied in the field of molecular biology, can solve the problems of destruction and inability to extract COI genes, etc., and achieve the effect of simple operation, species identification and high accuracy

Active Publication Date: 2021-08-13
CHINESE ACAD OF INSPECTION & QUARANTINE
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in some processed foods, the complete COI gene cannot be extracted due to the damage of its DNA. At this time, the extraction of a part of the COI gene (100bp-300bp) can also accurately identify the species

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for species identification of edible sea cucumber based on DNA microbarcoding technology
  • A method for species identification of edible sea cucumber based on DNA microbarcoding technology
  • A method for species identification of edible sea cucumber based on DNA microbarcoding technology

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0012] The present invention is further described by means of examples, but the present invention is not limited only to the following examples.

[0013] This embodiment is to evaluate the accuracy of the DNA micro-barcode amplification efficiency and identification of sea cucumbers through the following tests.

[0014] 1. Primer Design

[0015] Download the COI gene sequences of different species of edible sea cucumbers from the NCBI website, and use

[0016] MEGA6.0 software performs multiple alignments on sequences, removes identical sequences, and finds conserved regions. A pair of DNA micro-barcode primers MiniCOI-F: CATGGCTTTCCCTCGAATGAA, MiniCOI-R: TAACTCCTGGGGTTCGCATCT were designed using the conserved region combined with primmer5.0 software.

[0017] Table 1 PCR primers and their annealing temperature

[0018]

[0019] 2. Extraction of Genomic DNA from Samples

[0020] The improved CTAB method was used to extract sea cucumber DNA from 28 sea cucumber samples w...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a method for identifying species of edible sea cucumbers based on DNA micro-barcodes. The method extracts sea cucumber genomic DNA, and then uses DNA micro-barcode primers for PCR amplification to obtain a PCR product with a length of 257 bp. The DNA micro-barcode primers are MiniCOI‑F: CATGGCTTTCCCTCGAATGAA; MiniCOI‑R: TAACTCCTGGGGTTCGCATCT. Finally, the sequences of the DNA microbarcode fragments obtained by sequencing were compared at the National Center for Biotechnology Information (NCBI), and species identification was carried out according to the matching similarity of the sequences. The method is easy to operate and has high accuracy. It can identify commercially available sea cucumbers that have been processed and whose morphological characteristics have disappeared, and provides technical support for maintaining the interests of enterprises and consumers as well as normal market order.

Description

technical field [0001] The invention belongs to the field of molecular biology, in particular, the invention relates to a method for identifying edible sea cucumber species based on DNA micro-barcode technology. Background technique [0002] Sea cucumber belongs to the class Holothrioider of the phylum Echinodermata, and is divided into 3 subclasses, 6 orders and 25 families. At present, there are more than 1,500 species of sea cucumbers known in the world, among which there are about 60 species of sea cucumbers with high economic and edible value. As the largest consumer market for sea cucumbers, there are currently more than 20 kinds of sea cucumbers available for consumption in my country. Sea cucumber is considered as a high-protein, low-fat rare seafood in my country. It has high nutritional value and delicious taste. It is rich in more than 50 kinds of nutritional components such as protein, amino acid, multivitamins, essential fatty acids and trace elements. It also...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6888C12Q1/6869
CPCC12Q1/6869C12Q1/6888C12Q2531/113C12Q2535/101
Inventor 陈颖邢冉冉胡冉冉
Owner CHINESE ACAD OF INSPECTION & QUARANTINE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap