Nucleic acid aptamer binding to hepatoma cells and its application and detection method using the same
A nucleic acid aptamer, liver cancer cell technology, applied in the field of molecular biomedicine, can solve the problems of low tumor targeting, high immunogenicity, unsuitability, etc., achieves simple detection operation, easy in vitro synthesis and modification, and suitable for wide range of effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0065] Example 1 Screening of nucleic acid aptamers binding to liver cancer cells
[0066] The screening of aptamers is based on the screening of SELEX technology. Synthetic random oligonucleotide ssDNA library GP30 (5'-gcaatggtac ggtacttccn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnc aaaagtgcacgctactttgc taa-3', n represents any one of a, t, c, g),
[0067] Human immortalized liver cell line L-02 was used as subtracted cells, and the library GP30 was incubated with the subtracted cells, and the GP30 library that was not combined with the subtracted cells was incubated with the target cells. The target cells were human HepG2 and SMMC7721 liver cancer cells. , and then wash off the unbound part, elute the ssDNA bound to the target cells, and then amplify and recover by PCR. Repeat the above process for the second round of screening. After several rounds of screening, the enriched library was sequenced at high throughput, connected to the T vector, transformed into Ecoli, and cloned. Pi...
Embodiment 2
[0068] Example 2 Binding detection of nucleic acid aptamers binding to liver cancer cells and target cells
[0069] Cell preparation:
[0070] (a) The day before the experiment was the cell renewal medium, and the medium was high-sugar DMEM medium (gibco) containing 10% fetal bovine serum (Kang Yuan Biology);
[0071] (b) 75cm 2 Cultivate the cells in the culture flask to 70% full, and the cells are in the best growth state, rinse the cells twice with 3mL 1×PBS;
[0072] (c) Digest the cells with 1 mL of trypsin (including EDTA), wait until the cells become round, discard the trypsin, neutralize with 2 mL of complete medium, centrifuge at 1000 rpm for 5 min, and discard the supernatant;
[0073] (d) Wash the cells twice with 10 mL of serum-free DMEM medium, centrifuge at 1000 rpm for 3 min, and discard the supernatant (make sure there is no EDTA residue);
[0074] (e) Resuspend and count in an appropriate volume of washing buffer 1×PBS-1mM MgCl2, take 30,000 cells and put t...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More