Nucleic acid aptamer and derivatives thereof, screening method of nucleic acid aptamer, application of nucleic acid aptamer and derivatives in detecting human biliary duct carcinoma cell line

A technology of nucleic acid aptamer and screening method, which is applied in the determination/testing of microorganisms, biochemical equipment and methods, DNA preparation, etc. good effect

Active Publication Date: 2013-07-17
HUNAN UNIV
View PDF4 Cites 17 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Hilar cholangiocarcinoma is very difficult to operate because of its special location, invasive growth, and close relationship with hilar blood vessels.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleic acid aptamer and derivatives thereof, screening method of nucleic acid aptamer, application of nucleic acid aptamer and derivatives in detecting human biliary duct carcinoma cell line
  • Nucleic acid aptamer and derivatives thereof, screening method of nucleic acid aptamer, application of nucleic acid aptamer and derivatives in detecting human biliary duct carcinoma cell line
  • Nucleic acid aptamer and derivatives thereof, screening method of nucleic acid aptamer, application of nucleic acid aptamer and derivatives in detecting human biliary duct carcinoma cell line

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0046] A nucleic acid aptamer that can be used to detect the human hilar cholangiocarcinoma cell line QBC-939, the nucleotide sequence of the nucleic acid aptamer includes the DNA fragment shown in any one of the following sequences 1 to 2 ( The 5' end is labeled with FAM):

[0047] Sequence 1FAM-yl19:

[0048] 5'-AGAAGGATGGAGAGGAGCACACAATTGGGCGGGGTGTTGACGGGGGAGTTTAAAG

[0049] AAGTGGTCCTCGTCTCCTTCCTACT-3';

[0050] Sequence 2FAM-yl23:

[0051] 5'-AGAAGGATGGAGAGGAGCACCTAAGCGGGGTTCGAAGTATTTCTTATCTTTGCCTGG

[0052] ATTGTCCTCGTCTCCTTCCTACT-3'.

[0053] Serial 3FAM-RS80:

[0054] 5'-NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

[0055] NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN-3’

[0056] Note: N represents any base in A, T, G, and C (sequence 3 is used as a control sequence, that is, a negative probe, that is image 3 , Figure 4 Random in ).

[0057] A certain position on the nucleotide sequence of each nucleic acid aptamer mentioned above can be phosphorylated, methylate...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a nucleic acid aptamer with a sequence containing DNA (deoxyribonucleic acid) segments shown by any of a sequence 1 and a sequence 2. The nucleic acid aptamer can also be derivatives obtained by various similar sequences high in homology or the sequence. The invention further discloses a screening method of the nucleic acid aptamer. The method includes: synthesizing a random single-strand DNA library and a primer, performing Cell-SELEX screening and PCR (polymerase chain reaction) library amplification, preparing a DNA single-strand library, and obtaining the nucleic acid aptamer through repeated screening, negative screening and several rounds of screening. The nucleic acid aptamer and derivatives thereof can be applied to recognizing human biliary duct carcinoma cell line QBC-939 or preparing a reagent box for detecting the human biliary duct carcinoma cell line QBC-939, has affinity and specificity higher than anti-keratin antibodies, and is free of immunogenicity, capable of being chemically synthesized, small in molecular weight, stable, easy to store and mark, and the like.

Description

technical field [0001] The present invention relates to a nucleic acid aptamer and its screening and application, in particular to a nucleic acid aptamer which can be used to detect human cholangiocarcinoma cells and its screening method and application. Background technique [0002] Nucleic acid aptamers (aptamers) are single-stranded oligonucleotides (ssDNA or ssRNA) that can specifically bind to target substances and are screened by the systematic evolution of ligands by exponential enrichment (SELEX). Nucleic acid aptamers have similar functions to antibodies, but have more advantages than antibodies, with higher affinity and specificity; no immunogenicity; chemical synthesis, low cost; labeling; good stability, easy Preservation and other advantages. The target molecules of nucleic acid aptamers are more extensive, including metal ions, amino acids, nucleic acids, polypeptides, proteins, and expanded from single targets to complex targets such as complete virus particl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/115C12N15/10C12Q1/68C12Q1/04
Inventor王柯敏羊小海叶玲郭秋平谭誉宇何晓晓
OwnerHUNAN UNIV