Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

ppcer1-2 gene, carrier and its application in improving the drought resistance of gramineous plants

A gene and plant technology, applied in the field of plant breeding, can solve the problems of lacking, hindering plant drought resistance, lacking grass cuticles, etc.

Inactive Publication Date: 2021-08-20
SOUTHWEST UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] In summary, the problem in the prior art is that there is still a lack of effective gene resources for improving grass cuticle characteristics, especially the lack of waxy synthetic genes on grass non-model plants, thereby hindering the use of genetic engineering. The application of technology to improve the characteristics of cuticle and improve the drought resistance of plants

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • ppcer1-2 gene, carrier and its application in improving the drought resistance of gramineous plants
  • ppcer1-2 gene, carrier and its application in improving the drought resistance of gramineous plants
  • ppcer1-2 gene, carrier and its application in improving the drought resistance of gramineous plants

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0026] In order to make the object, technical solution and advantages of the present invention more clear, the present invention will be further described in detail below in conjunction with the examples. It should be understood that the specific embodiments described here are only used to explain the present invention, not to limit the present invention.

[0027] The application principle of the present invention will be described in detail below in conjunction with the accompanying drawings.

[0028] The sequence of the PpCER1-2 gene provided in the embodiment of the present invention is: SEQ ID NO:1.

[0029] Such as figure 1 As shown, the construction method of the PpCER1-2 gene provided by the embodiments of the present invention includes the following steps:

[0030] S101: According to the bluegrass leaf transcriptome data, design the upstream primer: ATGGCGACCAGGCCGGG (SEQ ID NO: 2), the downstream primer: TCAAGCTTTCGTCAGAGGGACGA (SEQ ID NO: 3), and use the first stra...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of plant breeding, and discloses a PpCER1-2 gene, a carrier and its application in improving the drought resistance of gramineous plants; the sequence of the PpCER1-2 gene is: SEQ ID NO:1. The present invention provides the application of PpCER1-2 gene in improving the drought resistance of gramineous plants; experiments prove that the PpCER1-2 gene has been transferred into and overexpressed Brachypodium distachyon leaves cuticle alkanes increase, and the water loss on the leaf surface slows down , the chlorophyll extraction rate decreased, and the growth of its seedlings in a drought environment also proved that the PpCER1‑2 gene can effectively improve the drought resistance of plants. Grasses are important food crops and garden green space plants. After improving the drought resistance of grasses through the present invention, the amount of irrigation water can be reduced, and at the same time, the problem of crop yield reduction caused by water shortage in summer high temperature weather can be enhanced, which has good application prospect.

Description

technical field [0001] The invention belongs to the technical field of plant breeding, and in particular relates to a PpCER1-2 gene, a carrier and its application in improving the drought resistance of gramineous plants. Background technique [0002] During the growth and development of plants, they are often affected by many abiotic stresses such as drought, salinity, low temperature, etc.; drought stress is one of the most common stress factors in various environmental stresses; improving the drought resistance of plants has become a modern plant breeding It is one of the key problems that need to be solved urgently. During the long-term evolutionary process, higher plants gradually evolved a series of physiological or developmental mechanisms to respond to water stress in the environment. This adaptability of plants involves many fields such as plant morphology, physiology, biochemistry and molecular biology. The tolerance of higher plants to water stress has the same m...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/52C12N15/10C12N15/82A01H5/00A01H6/46
CPCC12N9/00C12N15/8273
Inventor 郭彦军倪郁王党军徐熠
Owner SOUTHWEST UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products