ppcer1-2 gene, carrier and its application in improving the drought resistance of gramineous plants
A gene and plant technology, applied in the field of plant breeding, can solve the problems of lacking, hindering plant drought resistance, lacking grass cuticles, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0026] In order to make the object, technical solution and advantages of the present invention more clear, the present invention will be further described in detail below in conjunction with the examples. It should be understood that the specific embodiments described here are only used to explain the present invention, not to limit the present invention.
[0027] The application principle of the present invention will be described in detail below in conjunction with the accompanying drawings.
[0028] The sequence of the PpCER1-2 gene provided in the embodiment of the present invention is: SEQ ID NO:1.
[0029] Such as figure 1 As shown, the construction method of the PpCER1-2 gene provided by the embodiments of the present invention includes the following steps:
[0030] S101: According to the bluegrass leaf transcriptome data, design the upstream primer: ATGGCGACCAGGCCGGG (SEQ ID NO: 2), the downstream primer: TCAAGCTTTCGTCAGAGGGACGA (SEQ ID NO: 3), and use the first stra...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com