An improved red fluorescent protein and its application
A technology of red fluorescent protein and biomaterials, applied in the fields of application, fluorescence/phosphorescence, plant gene improvement, etc., can solve the problem of short wavelength, maturation speed, fluorescence intensity, wavelength unsuitable for thick specimens and live animal imaging experiments, cells or tissue toxicity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Example 1 Construction of the red fluorescent protein eqFP578 mutant library
[0039] Through the analysis of the protein structure of the pacifier sea anemone (Entacmaea quadricolor) red fluorescent protein eqFP578 (see SEQ ID NO.1 for the amino acid sequence) by Discovery studio4.0 software, find out 32 sites that may affect the structure of eqFP578, these 32 sites Yes: L4, K6, N21, G30, P52, L58, M63, H72, L79, E86, I93, L102, T103, F110, N112, I115, V124, N129, M133, A142, N143, G152, S158, G166, H171, F174, K181, H193, R198, M216, K220, H230, these 32 points are staggered and divided into 8 groups (Table 1), and saturation mutations are performed on the amino acids at each site in each group, thus obtaining 8 groups of saturation Mutated gene bank; In addition, the eqFP578 gene was randomly mutated by the error-prone PCR method to obtain a group of mutant gene banks; the mOrange2 gene was randomly mutated by the error-prone PCR method to obtain a group of mutant ge...
Embodiment 2
[0046] Example 2 Screening of red fluorescent protein eqFP578 mutant clones
[0047] Spread the eqFP578-DS library evenly on the ZYM-AT self-inducing medium plate (1% tryptone, 0.5% yeast extract, 25mM Na 2 HPO 4 , 25mM KH 2 PO 4 , 50mM NH 4 Cl, 5mM Na 2 SO 4 , 0.5% glycerol, 0.05% glucose, 0.2% a-lactose, 2mM MgSO 4 , 0.2x trace elements, 1% agar, 50 μg / mL Amp and 10 μg / mL Tet), cultured overnight at 30 ° C, the single clones in the eqFP578-DS library expressed mutant fluorescent proteins, showing different brightness and color. Observe the plate and circle the brighter red colonies with a marker. The next step is to prepare ZYM-AT self-inducing liquid medium, and add 200 μl ZYM-AT liquid medium to each well of a 96-well deep-well plate. Then these bright red colonies were picked out and inoculated into 96-well plates, a total of 1820 clones were picked, and all deep-well plates were placed in a shaker at 30°C and 200rpm for 16 hours for fluorescent protein expression...
Embodiment 3
[0052] Construction and expression of embodiment 3RFPSpark mutant fluorescent protein and FP650 fluorescent protein eukaryotic expression vector
[0053]Using primers RFP-inf-F: 5'GGTACCGCTAGCGGATCCATGGTGAGCAAGGGCGAGGAG 3' (SEQ ID NO.8) and RFP-inf-R: 5'GGCCGCTCTAGACTCGAGTCACTTGTACAGCTCGTCCAT 3' (SEQ ID NO.9) to amplify the RFPSpark gene with the mutant type screened as a template, The infusion enzyme was connected to the eukaryotic expression vector pCMV3, and the correct plasmid pCMV3-RFPSpark was identified. The pCMV3-RFPSpark plasmid with transfection grade purity was purified and transfected into 293H cells.
[0054] The specific steps are as follows: 293H cells are cultured in DMEM medium containing 10% fetal bovine serum at 37°C and 5% carbon dioxide. Before transfection, the cells were divided into 1*10 5 The density of cells / well was inoculated in 24-well plates and used for transfection after 24 hours of culture, and the cell density was 70%-90%. 2μg DNA and a cer...
PUM
| Property | Measurement | Unit |
|---|---|---|
| emission peak | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


