Chimeric antigen receptor of targeted mesothelin and method and use for jointly expressing IL-15
A single-chain antibody, fusion protein technology, applied in the direction of targeting specific cell fusion, peptides containing localization/targeting motifs, receptors/cell surface antigens/cell surface determinants, etc., can solve the biological problems of Mesothelin.  Function is not clear, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
 AI Technical Summary 
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0075] Example 1: Determination of Mesothelin CAR-mbIL15 gene sequence
[0076] The human IL15 and IL15Rα mature peptide sequence information was searched from the NCBI website database, and the sequence was codon-optimized on the website http: / / sg.idtdna.com / site to ensure that it is more suitable for human cells without changing the encoded amino acid sequence Express.
[0077] For the sequence information of each gene, see SEQENCE LISTING (SEQUENCE ID NO.1-2)
[0078] The above sequences were connected sequentially, and different enzyme cutting sites were introduced at the junctions of each sequence to form the complete MesothelinCAR-mbIL15 gene sequence information.
Embodiment 2
[0079] Embodiment 2: the construction of the viral vector comprising the nucleic acid sequence of CAR molecule
[0080] The nucleotide sequence of the CAR molecule prepared in Example 1 was double-digested by NotI (NEB) and EcoRI (NEB), connected by T4 ligase (NEB) and inserted into the NotI-EcoRI position of the retroviral RV vector (MSCV) point, transformed into competent E.coli (DH5α), the recombinant plasmid was sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing, and the sequencing results were compared with the fitted Meso CAR-mbIL15 sequence to verify whether the sequence was correct.
[0081] The sequencing primers are:
[0082] Sense sequence: AGCATCGTTCTGTGTTGTCTC (SEQUENCE ID NO.3)
[0083] Antisense sequence: TGTTTGTCTTGTGGCAATACAC (SEQUUNCE ID NO.4)
[0084] After the sequencing was correct, the plasmid was extracted and purified using a plasmid purification kit from Qiagen, and the purified plasmid was transfected into 293T cells by the plasmid calci...
Embodiment 3
[0086] Example 3: Retroviral Packaging
[0087] 1. On the first day, the 293T cells should be less than 20 passages and not overgrown. Plate with 0.6*10^6 cells / ml, add 10ml of DMEM medium to a 10cm dish, mix the cells well, and culture overnight at 37 degrees;
[0088] 2. On the second day, the confluence of 293T cells reaches about 90% for transfection (usually about 14-18 hours after plating); prepare plasmid complexes, the amount of various plasmids is 12.5ug for Retro backbone, 10ug for Gag-pol, and 10ug for VSVg 6.25ug, CaCl 2 250ul,H 2 O is 1ml and the total volume is 1.25ml; add HBS equal to the volume of the plasmid complex in another tube, and vortex for 20 seconds while adding the plasmid complex. Gently add the mixture to the 293T dish along the side, incubate at 37°C for 4 hours, remove the medium, wash it with PBS, and add pre-warmed fresh medium again.
[0089] 3. Day 4: 48 hours after transfection, collect the supernatant and filter it with a 0.45um filter...
PUM
 Login to View More
 Login to View More Abstract
Description
Claims
Application Information
 Login to View More
 Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



