RPA primer for detecting mycoplasma ovipneumoniae

A technology of mycoplasma pneumoniae and sheep, applied in the direction of microorganism-based methods, DNA/RNA fragments, microorganisms, etc., can solve the problems of high nutritional requirements of the medium, difficult growth, poor specificity, etc., and achieve accurate detection results, good repeatability, The effect of high sensitivity

Inactive Publication Date: 2018-11-30
INST OF ANIMAL HUSBANDRY & VETERINARY FUJIAN ACADEMY OF AGRI SCI
View PDF2 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The diagnostic methods of Mycoplasma pneumoniae mainly include isolation and identification of mycoplasma, conventional PCR, serological methods and SYBR Green I RF-PCR. Both fluorescent quantitative PCR and fluorescent quantitative PCR require special instruments, and serological methods have disadvantages such as low sensitivity and poor specificity, and it is impossible to quickly detect clinical samples in time

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • RPA primer for detecting mycoplasma ovipneumoniae
  • RPA primer for detecting mycoplasma ovipneumoniae

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Embodiment 1: be used to detect the establishment of the RPA method of ovine mycoplasma pneumoniae

[0024] 1. Design and synthesis of primers

[0025] The specificity of the primers is an important factor in the method established in this experiment. According to the p80 gene sequence of KM435069.1 registered in GenBank, primers were designed by using Oligo 7 software, and their specificity was preliminarily verified by comparison and analysis by BLAST software. Primer synthesis was completed by Sangon Bioengineering (Shanghai) Co., Ltd.

[0026] The nucleotide sequence of the RPA primer is:

[0027] Primer upstream P1: 5'- CTTAATGATGAGCGTAGTAGATACCAAACCAC -3',

[0028] Downstream primer P2: 5'-GCTGAGGTCGGATTTGGACTAACAATATTTG-3'.

[0029] The size of the amplified fragment was 353 bp.

[0030] 2. Preparation of positive standard

[0031] Using the extracted DNA as a template, take 1 mL of Mycoplasma ovis pneumoniae culture solution and add it to a 1.5 mL centrifu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a RPA primer for detecting mycoplasma ovipneumoniae. The upstream primer P1 is 5'-CTTAATGATGAGCGTAGTAGATACCAAACCAC-3', and the downstream primer P2 is 5'-GCTGAGGTCGGATTTGGACTAACAATATTTG-3'. The RPA primer is high in specificity, high in sensitivity and accurate in detection result. The invention further provides a RPA method for detecting the mycoplasma ovipneumoniae. The RPA method comprises the steps of primer synthesis, extraction of DNA in to-be-detected samples, RPA amplification, amplification product analysis and the like. The detecting method is easy to operate,and the quick, convenient and specific diagnostic method is provided for effective detecting and identifying the mycoplasma ovipneumoniae by basic veterinary workers.

Description

technical field [0001] The invention belongs to the technical field of rapid diagnosis of veterinary infectious diseases, and in particular relates to an RPA primer and a method for detecting Mycoplasma pneumoniae of sheep. Background technique [0002] Mycoplasma ovipneumoniae (Mo) is the main pathogen causing Mycoplasma pneumonia of goats and sheep (MPGS). MPGS is highly contagious, mainly through respiratory tract infection, and can also be transmitted vertically. Sick sheep and resistant sheep are the main sources of infection of the disease. The clinical symptoms of MPGS are high fever, cough, panting, progressive emaciation, and serous and fibrinous inflammation of the lung and pleura. . At present, there are reports of the disease occurring in Africa, Spain, Italy, the United States, Jordan abroad, Sichuan, Guizhou, Inner Mongolia, Qinghai, Guangxi, Fujian and other places in China, causing serious economic losses to the sheep industry. [0003] Conventional PCR te...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/689C12Q1/6844C12Q1/04C12N15/11C12R1/35
CPCC12Q1/6844C12Q1/689C12Q2521/507C12Q2522/101
Inventor 林裕胜胡奇林江锦秀张靖鹏游伟
Owner INST OF ANIMAL HUSBANDRY & VETERINARY FUJIAN ACADEMY OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap