Aggregation-induced emission/surface plasma chroma analysis dual mode nucleic acid detection method

A technology of aggregation-induced luminescence and surface plasmon, which is applied in the measurement/inspection of microorganisms, biochemical equipment and methods, etc., can solve the problems of increasing operation difficulty and cost, and achieve low cost, low background signal, and chemical label-free Effect

Active Publication Date: 2018-12-07
SOUTH CHINA UNIV OF TECH
View PDF5 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This greatly increases the difficulty and cost of operation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Aggregation-induced emission/surface plasma chroma analysis dual mode nucleic acid detection method
  • Aggregation-induced emission/surface plasma chroma analysis dual mode nucleic acid detection method
  • Aggregation-induced emission/surface plasma chroma analysis dual mode nucleic acid detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] (1) H1 and H2 DNA were first dissolved in 1×PBS buffer, and then heated to 95°C, kept at a constant temperature for 5 minutes, and then lowered to room temperature and kept for 1 hour. Then mix H1 and H2 for later use. The sequences of H1 and H2 DNA are:

[0035] DNA-H1: ttaacccacgccgaatcctagactcaaagtagtctaggattcggcgtg (SEQ ID No. 1);

[0036] DNA-H2: agtctaggattcggcgtgggttaacacgccgaatcctagactactttg (SEQ ID No. 2).

[0037] (2) Different concentrations of target DNA (0.0625 μM, 0.125 μM, 0.25 μM, 0.5 μM and 1 μM) were mixed with H1 and H2, and reacted at room temperature for 2 hours to obtain HCR reaction products. The HCR product was processed by ultrafiltration to reduce background signal. The specific steps are as follows: the HCR product is firstly diluted with 1×PBS with a dilution factor of 4, and then the diluted solution is added to a 100 kDa (purchased from Millipore) ultrafiltration tube. The samples were centrifuged (10000r / min, 2min) and then sonicated f...

Embodiment 2

[0053] (1) AuNPs were first incubated overnight with thiol-modified DNA, and the molar concentration ratios of AuNPs to DNA were 1:50 (low), 1:100 (moderate) and 1:300 (high). Then add 10 μL of 1×PBS solution to the solution every half hour for a total of three times. React at room temperature for 7 hours. The samples were then centrifuged and washed three times with deionized water. Finally, the precipitate was resuspended with deionized water to a concentration of 10 nM to obtain a gold nanoparticle solution modified with thiol DNA (the DNA modified on the gold nanoparticle is to improve the stability of the gold nanoparticle, and its sequence can be any sequence).

[0054] (2) Take 3 different molar ratios of sulfhydryl DNA-modified gold nanoparticle solutions, take 100 μL each and add them to a 96-well plate (a total of 6 wells), and add TA-TPE to the final concentrations of 0.5 μmol and 1 μmol respectively , 2μmol, 3μmol, 4μmol, 5μmol. Take pictures to observe the chan...

Embodiment 3

[0057] The detection method for microRNA in this embodiment is similar to the detection method for DNA in Example 1. Different from DNA, the sequences of H1 and H2 used in RNA and detection are as follows:

[0058] RNA sequence: uggagugugacaaugguguuuga (SEQ ID No.10);

[0059] RNA-H1: tggagtgtgacaatggtgtttgaaccattgtcacactccaaattgc (SEQ ID No. 11);

[0060] RNA-H2: tcaaacaccattgtcacactccagcaatttggagtgtgacaatggt (SEQ ID No. 12).

[0061] In this example, the fluorescence spectra of TA-TPE interacted with HCR products of different concentrations of target RNA (target RNA concentrations were 0, 10nM, 20nM, 40nM, 60nM, 80nM, 100nM) were as follows: Figure 8 Shown in a; according to the standard curve of fluorescence intensity and microRNA concentration in a Figure 8 Shown in b. from Figure 8 It can be seen that as the concentration of target RNA increases, the fluorescence intensity also increases, and presents a good linearity.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
sizeaaaaaaaaaa
Login to View More

Abstract

The invention belongs to the technical field of biodetection and discloses an aggregation-induced emission / surface plasma chroma analysis dual mode nucleic acid detection method. The method comprisesthe following steps: carrying out a hybrid chain reaction to amplify a signal of a target nucleotide sequence to obtain an HCR reaction product; mixing water soluble aggregation-induced emission molecules with HCR reactants of different concentrations, and drawing a standard curve of concentration of nucleic acids by measuring the fluorescence intensity to analyze the nucleic acids quantitatively;and adding gold nanoparticles modified by sulfydryl DNA into the HCR reactants adsorbing the aggregation-induced emission molecules, and observing color change of the solution to analyze the nucleicacids qualitatively, wherein the water soluble aggregation-induced emission molecules have the structural formula as shown in a formula (I). The detection method combining aggregation-induced emissioneffect and surface plasma chroma analysis has the advantages of being simple, real-time, free of purifying treatment and the like.

Description

technical field [0001] The invention belongs to the technical field of biological detection, in particular to an aggregation-induced luminescence / surface plasmon chromaticity analysis dual-mode nucleic acid detection method. Background technique [0002] With the development of modern molecular diagnostic methods, nucleic acid molecular detection / analysis has gained more and more attention in the fields of tumor diagnosis, pathogenic microorganism identification and genetic disease screening. The recently developed non-invasive liquid biopsy method shows that nucleic acid fragments in the blood can provide information on the genes of the fetus, tumor recurrence and the type of infectious disease. However, traditional nucleic acid detection methods, such as polymerase chain reaction (PCR), electrochemical analysis, and Southern / Northern blot hybridization methods, have problems such as high cost, complicated operation, and slow response speed. It is of great significance to ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/6851C12Q1/6886C12Q1/04C12Q1/6841
CPCC12Q1/6841C12Q1/6851C12Q1/6886C12Q2531/113C12Q2525/301C12Q2525/186C12Q2563/107C12Q2565/1015
Inventor唐本忠沈建磊秦安军张忆茹
OwnerSOUTH CHINA UNIV OF TECH