Unlock instant, AI-driven research and patent intelligence for your innovation.

A closed dna fluorescent biosensor and its application in detecting influenza A h1n1 virus

A biosensor and influenza virus technology, applied in the field of biochemical analysis, can solve the problems of false negatives, unsuitable for large-scale screening and detection at the grassroots level, and achieve the effects of easy portability, convenient standardized operation, and low process cost

Active Publication Date: 2022-04-08
GUANGDONG OCEAN UNIVERSITY
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Real-time fluorescence quantitative PCR detection has high specificity and sensitivity, but false negative results may also occur. During the entire detection process, there are high technical requirements for operators, precision laboratory instruments and overall laboratory facilities. , not suitable for large-scale screening and detection at the grassroots level

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A closed dna fluorescent biosensor and its application in detecting influenza A h1n1 virus
  • A closed dna fluorescent biosensor and its application in detecting influenza A h1n1 virus
  • A closed dna fluorescent biosensor and its application in detecting influenza A h1n1 virus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0067] Example 1 Detection of H1N1

[0068] (1) Add 50 μL Oligo-1 (12 μM), 50 μL Oligo-2 (10 μM), 50 μL KCl (500 mM) and 50 μL of target single-stranded DNA (Oligo-3) or samples to be tested in different series of concentrations, and a blank control group was set at the same time (the buffer solution without sample to be tested, only signal probe, auxiliary probe and potassium ion solution was used as blank control group), heated to 88°C for 10 minutes after mixing;

[0069] (2) Gradually cool down to room temperature to form closed double-stranded DNA; then add 50 μL of NMM (48 μM) to the above solution, and incubate at room temperature (20-28°C) for 15 minutes;

[0070] (3) Transfer the above solution to a fluorescence detector, and measure the difference in fluorescence intensity between the experimental group and the blank control group at room temperature; calculate the regression equation according to the standard curve of target single-stranded DNA concentration-fluore...

Embodiment 2

[0074] Embodiment 2 Fluorescence intensity varies with the ratio of Oligo-1 and Oligo-2

[0075] 1. Method

[0076] On the basis of Example 1, the mol ratio of Oligo-1 and Oligo-2 is used as a single factor variable, and ΔI is used as an index (ΔI is defined as the difference of fluorescence intensity, and the definition formula of ΔI is ΔI=I blank -I target , I target A fluorescent signal indicating the presence of the target strand, I blank Indicates that no target strand is added to the fluorescent signal), and the influence of different ratios of Oligo-1 and Oligo-2 on the detection effect of H1N1 virus-specific single-stranded DNA sequences was investigated.

[0077] 2. Results

[0078] Experimental results such as figure 2 As shown, the auxiliary strand (Oligo-2) can hybridize with Oligo-1 and the target strand (Target DNA), and inhibit the formation of G-quadruplexes. The change of the ratio of Oligo-1 and Oligo-2 significantly affects the intensity of the detecte...

Embodiment 3

[0079] Embodiment 3 Fluorescence intensity changes with the ratio of Oligo-1 and NMM

[0080] 1. Method

[0081] On the basis of Example 1, the ratio of Oligo-1 and NMM was used as a single factor variable, and ΔI was used as an index to investigate the influence of different ratios of Oligo-1 and NMM on the detection effect of H1N1 virus-specific single-stranded DNA sequences.

[0082] 2. Results

[0083] Experimental results such as image 3 As shown, the fluorescent dye NMM must be combined with the G-quadruplex in a certain ratio to achieve the maximum fluorescent signal value. Depend on image 3It can be seen that when the molar ratio of the signal probe to the fluorescent dye is 1:1-6, the detection effect is better; the fluorescence intensity of the detection system increases gradually with the ratio of Oligo-1 to NMM, and when the G-quadruplex When the molar ratio of probe to NMM is 1:4, the net increase ΔI of the fluorescence signal value of the detection system r...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a closed type DNA fluorescent biosensor and its application in detecting influenza A H1N1 virus. The sensor includes an auxiliary probe, a signal probe and a fluorescent dye that can specifically bind to the signal probe; wherein, the sequence of the signal probe is 5'-TCCTATTGTGACTTTGGGTAGGG CGGGTTGGG-3'; the sequence of the auxiliary probe is 5'- GCCCTACCCGGGTGTTATATTCTG‑3'. The enclosed DNA fluorescent biosensor of the invention can rapidly detect the concentration of the specific single-stranded DNA sequence of the influenza A H1N1 virus through the change of the fluorescence value, has high sensitivity, good specificity, is convenient for standardized operation, and is suitable for clinical screening, etc. The advantages of the invention provide certain theoretical guidance for the development of rapid detection products for influenza A H1N1 virus, and are of great significance to the clinical monitoring of epidemic viruses.

Description

technical field [0001] The invention belongs to the technical field of biochemical analysis. More specifically, it relates to a closed-type DNA fluorescent biosensor and its application in detecting influenza A (H1N1) virus. Background technique [0002] H1N1 is an RNA virus belonging to the Orthomyxoviridae family. After the mutation and transmission of H1N1 virus hosts, it will lead to the outbreak and spread of large-scale epidemics and human influenza. In March 2009, this new type A H1N1 influenza virus broke out in the United States, Mexico and other countries, and then spread rapidly around the world, resulting in a large-scale virus disaster, which is extremely harmful to humans and animals. In the late stage of the H1N1 influenza virus epidemic, the influenza epidemic is still breaking out in different regions, and the influenza virus is likely to mutate and develop drug resistance. The mutation will make it more easily spread and cause disease. Bacteria have serio...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/70C12Q1/6825
CPCC12Q1/6825C12Q1/701C12Q2563/107C12Q2563/137
Inventor 李宇彬
Owner GUANGDONG OCEAN UNIVERSITY