PCR primer and method for detecting genotyping of SNP sites of ACVR1 gene
A genotyping and site technology, applied in biochemical equipment and methods, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problems of incomplete enzyme digestion, cumbersome operation, high detection cost, etc., to ensure accuracy , to overcome the relatively inefficient effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0032] The following will clearly and completely describe the technical solutions in the embodiments of the present invention with reference to the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only some, not all, embodiments of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by persons of ordinary skill in the art without making creative efforts belong to the protection scope of the present invention.
[0033] A kind of detection ACVR1 gene SNP locus genotyping PCR primer, specifically as follows:
[0034]ACVR1 gene PCR primer sequence information:
[0035] >15dna:chromosome chromosome:Sscrofa10.2:15:72093370:72093970:1
[0036] TCCCCAGGGGTGGATGTTGACCCAAGGACCCTTTGTCTGATCTTGCCCCCTTTCTCCTGCCTTCTCATTCTCATAACTAGAAGGTGAGGTCCTCCTTATTCCTTTTCTTCTGGTCTGATATGAAATACCCTTACACTGAATTCTCCTGACTTCTAGCAATTGCCATGATCAAGTTCAGGAAACCTAGACTTCAAGTATGTTAATAGAAACATAAACATTTTTCAAATCCTTAT...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


