Unlock instant, AI-driven research and patent intelligence for your innovation.

PCR primer and method for detecting genotyping of SNP sites of ACVR1 gene

A genotyping and site technology, applied in biochemical equipment and methods, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problems of incomplete enzyme digestion, cumbersome operation, high detection cost, etc., to ensure accuracy , to overcome the relatively inefficient effect

Pending Publication Date: 2019-04-12
HENAN AGRICULTURAL UNIVERSITY
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Aiming at the deficiencies of the prior art, the present invention provides a PCR primer and method for detecting the SNP site genotyping of the ACVR1 gene. By introducing an internal control enzyme cutting site into the PCR product, the fast enzyme NdeI used to cut the PCR product is overcome. The efficiency of enzyme digestion is relatively low, and it is easy to cause the disadvantage of incomplete digestion. The situation of incomplete digestion can be identified according to the electrophoretic pattern of the digestion product, and in the case of incomplete digestion, it can still be detected according to the characteristic conditions of each genotype. The genotype can be identified according to the condition of the band, which ensures the accuracy of the genotype, and solves the problem that the current genotyping method of the SNP site of the ACVR1 gene requires high-quality personnel, cumbersome operations, and high testing costs.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • PCR primer and method for detecting genotyping of SNP sites of ACVR1 gene
  • PCR primer and method for detecting genotyping of SNP sites of ACVR1 gene
  • PCR primer and method for detecting genotyping of SNP sites of ACVR1 gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0032] The following will clearly and completely describe the technical solutions in the embodiments of the present invention with reference to the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only some, not all, embodiments of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by persons of ordinary skill in the art without making creative efforts belong to the protection scope of the present invention.

[0033] A kind of detection ACVR1 gene SNP locus genotyping PCR primer, specifically as follows:

[0034]ACVR1 gene PCR primer sequence information:

[0035] >15dna:chromosome chromosome:Sscrofa10.2:15:72093370:72093970:1

[0036] TCCCCAGGGGTGGATGTTGACCCAAGGACCCTTTGTCTGATCTTGCCCCCTTTCTCCTGCCTTCTCATTCTCATAACTAGAAGGTGAGGTCCTCCTTATTCCTTTTCTTCTGGTCTGATATGAAATACCCTTACACTGAATTCTCCTGACTTCTAGCAATTGCCATGATCAAGTTCAGGAAACCTAGACTTCAAGTATGTTAATAGAAACATAAACATTTTTCAAATCCTTAT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of molecular detection and discloses a PCR primer and a method for detecting genotyping of SNP sites of an ACVR1 gene. The method comprises the following steps: design and synthesis of the PCR primer: designing the primer for PCR in NCBI according to a swine ACVR1 gene sequence predicted on NCBI, wherein the final concentration of the primer after dilution is 10 pmol / L; step 2, PCR amplification: taking muscular tissue DNA extracted in the step 1 as a template, performing PCR amplification by the primer according to the reaction procedure of PCR amplification; and step 3, reaction system amplification. According to the PCR primer and a method for detecting genotyping of SNP sites of the ACVR1 gene, internal contrast enzyme digestion sites are introduced into a PCR product, the defects that the used fast enzyme NdeI digestion efficiency of the PCR product is lower and incomplete enzyme digestion can be caused easily are overcome, the condition of incomplete enzyme digestion can be recognized according to an electrophoretogram, besides, the genotyping can be distinguished according to the condition of characteristic strip of each genotypeunder the condition of incomplete enzyme digestion, and accuracy of genotype distinguishing is guaranteed.

Description

technical field [0001] The invention relates to the technical field of molecular detection, in particular to a PCR primer and a method for detecting the SNP site genotyping of ACVR1 gene. Background technique [0002] The ACVR1 gene is essential for embryonic development and growth, involves multiple cells and tissue types, such as muscle, bone, and nervous system, and has temporal and spatial expression specificity during mouse development. Studies have shown that knocking out the ACVR1 gene causes mouse embryos to block early in development, so conditional mutants are often used to study the function of the ACVR1 gene in tissue / organ development. The current research on the ACVR1 gene is mainly focused on the research of progressive muscle ossification disease (Fibrodysplasia Ossificans Progressiva, FOP) and glioma (Diffuse Intrinsic Pontine Glioma, DIPG), and revealed the key mutations related to the two . [0003] At present, methods for detecting the genotype of ACVR1...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6886C12Q1/6883C12N15/11
CPCC12Q1/6883C12Q1/6886C12Q2600/156
Inventor 李新建叶建伟李秀领王克君韩雪蕾乔瑞敏吕刚
Owner HENAN AGRICULTURAL UNIVERSITY